[BioMart Users] Problem with biomaRt::getSequence

classic Classic list List threaded Threaded
7 messages Options
Reply | Threaded
Open this post in threaded view
|

[BioMart Users] Problem with biomaRt::getSequence

Mohammad Tanvir Ahamed
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Steffen Durinck-2
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Syed Haider-4
Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[hidden email]> wrote:
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Rhoda Kinsella
Hi Steffen
FYI, Tanvir tried his query against the Ensembl mart database at www.ensembl.org and it works fine. Please point your host to http://www.ensembl.org/biomart/martview/ until the issue at www.biomart.org is fixed.
Regards
Rhoda

On 9 May 2013, at 08:00, Syed Haider <[hidden email]> wrote:

Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[hidden email]> wrote:
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users

Rhoda Kinsella Ph.D.
Ensembl Production Project Leader,
European Bioinformatics Institute (EMBL-EBI),
Wellcome Trust Genome Campus,
Hinxton,
Cambridge,
CB10 1SD




_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Steffen Durinck-2
In reply to this post by Syed Haider-4
Hi Syed,

I doubt it is a space issue in this case as only 2 sequences are being retrieved, unless some big table merge happens on your side first before these two sequences are pulled out.

Cheers,
Steffen


On Thu, May 9, 2013 at 12:00 AM, Syed Haider <[hidden email]> wrote:
Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[hidden email]> wrote:
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users



_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Arek Kasprzyk
In reply to this post by Syed Haider-4
Hi guys,
I fixed this as per Syed's suggestions, checked a couple of sequences and they seem to be ok. 

Please let us know if there are any other issues

a


On 9 May 2013 08:00, Syed Haider <[hidden email]> wrote:
Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[hidden email]> wrote:
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users
Reply | Threaded
Open this post in threaded view
|

Re: [BioMart Users] Problem with biomaRt::getSequence

Steffen Durinck-2
Thanks Arek,

I check the query in R and it is indeed working again!

Cheers,
Steffen


On Thu, May 9, 2013 at 12:29 PM, Arek Kasprzyk <[hidden email]> wrote:
Hi guys,
I fixed this as per Syed's suggestions, checked a couple of sequences and they seem to be ok. 

Please let us know if there are any other issues

a


On 9 May 2013 08:00, Syed Haider <[hidden email]> wrote:
Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[hidden email]> wrote:
Hi list,

I included the actual XML query that results in the error Mohammad is reporting:

The query: 
<?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  virtualSchemaName = 'default' uniqueRows = '1' count = '0' datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' /></Dataset></Query>

gives:

caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This comes from the central BioMart server (www.biomart.org), can anyone help?

Best,
Steffen


On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[hidden email]> wrote:
Hi,
I can run the code some days ago . But cant run now. 

Problem 1: Output is ok
ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
Output : 
                                                                                              5utr  entrezgene
                                                                             Sequence unavailable      10644
                                             GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                 CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
                                                         No UTR is annotated for this transcript      10644
 
Problem 2:Problem is here
protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)

Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
  Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

I need help please
 
/.......Tanvir Ahamed

_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users


_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users



_______________________________________________
Users mailing list
[hidden email]
https://lists.biomart.org/mailman/listinfo/users