Coverage track not working

classic Classic list List threaded Threaded
6 messages Options
Reply | Threaded
Open this post in threaded view

Coverage track not working



I am working with two databases in my configuration file and need to display coverage tracks for both of them.
One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.

The track definitions for databases rnaseqall and ovarysam:

#This coverage track works
feature                 = coverage
glyph                   = wiggle_xyplot
database             = rnaseqall
height                  = 50
fgcolor                 = black
bicolor_pivot       = 20
pos_color             = royalblue
neg_color             = red
key                     = Coverage from RNA-Seq
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#This track does not work correctly. A scale with and a few non-matching peeks are shown.
feature                 = coverage
glyph                   = wiggle_xyplot
database                = ovarysam
height                  = 50
fgcolor                 = black
bicolor_pivot           = 20
pos_color               = royalblue
neg_color               = red
key                     = Coverage ovary
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#Correct data is shown
feature        = match
glyph          = segments
database       = ovarysam
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bgcolor        = royalblue
fgcolor        = black
height         = 5
label density  = 50
feature_limit  = 5000
bump           = fast
connector      = solid
key            = RNA-Seq reads match ovary
category       = Experimental Data


Is there a method to verify the bam files are correct?
What could be causing the coverage track to be wrong?

Best Regards
Stefan Pfeiffer

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]
Reply | Threaded
Open this post in threaded view

Re: Coverage track not working

Scott Cain
Hi Stefan,

I know that there can be problems associated with sampling the bam data when drawing coverage plots. Have you tried zooming in and out to see if the coverage plot changes to look more "right".  Similarly, have you tried opening the bam file in other software like IGV to see if it looks right? 


On Mon, May 8, 2017 at 11:59 AM, Stefan Pfeiffer <[hidden email]> wrote:


I am working with two databases in my configuration file and need to display coverage tracks for both of them.
One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.

The track definitions for databases rnaseqall and ovarysam:

#This coverage track works
feature                 = coverage
glyph                   = wiggle_xyplot
database             = rnaseqall
height                  = 50
fgcolor                 = black
bicolor_pivot       = 20
pos_color             = royalblue
neg_color             = red
key                     = Coverage from RNA-Seq
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#This track does not work correctly. A scale with and a few non-matching peeks are shown.
feature                 = coverage
glyph                   = wiggle_xyplot
database                = ovarysam
height                  = 50
fgcolor                 = black
bicolor_pivot           = 20
pos_color               = royalblue
neg_color               = red
key                     = Coverage ovary
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#Correct data is shown
feature        = match
glyph          = segments
database       = ovarysam
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bgcolor        = royalblue
fgcolor        = black
height         = 5
label density  = 50
feature_limit  = 5000
bump           = fast
connector      = solid
key            = RNA-Seq reads match ovary
category       = Experimental Data


Is there a method to verify the bam files are correct?
What could be causing the coverage track to be wrong?

Best Regards
Stefan Pfeiffer

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]

Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (                     216-392-3087
Ontario Institute for Cancer Research

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]
Reply | Threaded
Open this post in threaded view

Re: Coverage track not working


Hi Scott,

thank you for the suggestion. IGV does show the correct and expected coverage.
Zooming in GBrowse does not change anything.
You can see the result at

If it is helpful, we could also upload the bam file.
samtools view wrong_coverage.bam returns lines like the following.  The position/length integers in the 8th/9th column remain 0 throughout the entire file, which is not the case for correct_coverage.bam. Could this be the cause?

ILLUMINA-D0898A_0001:1:94:15808:4394#0/1        0       NW_015452213.1  1447    40      38M     *       0       0       TGTGGTACTCGTGTACACAGCAGAAGAATTATCAGTAT  bbbbbbbbbbbbbbbbbbabbbbbbbbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0
ILLUMINA-D0898A_0001:1:2:16831:1638#0/1 0       NW_015452213.1  1449    40      38M     *       0       0       TGGTACTCGTGTACACAGCAGAAGAATTATCAGTATAA  ]abbbbbbabaabbbbbbbbbbbbabbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0

Best Regards


On 2017-05-10 16:51, Scott Cain wrote:

Hi Stefan,
I know that there can be problems associated with sampling the bam data when drawing coverage plots. Have you tried zooming in and out to see if the coverage plot changes to look more "right".  Similarly, have you tried opening the bam file in other software like IGV to see if it looks right? 

On Mon, May 8, 2017 at 11:59 AM, Stefan Pfeiffer <[hidden email]> wrote:


I am working with two databases in my configuration file and need to display coverage tracks for both of them.
One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.

The track definitions for databases rnaseqall and ovarysam:

#This coverage track works
feature                 = coverage
glyph                   = wiggle_xyplot
database             = rnaseqall
height                  = 50
fgcolor                 = black
bicolor_pivot       = 20
pos_color             = royalblue
neg_color             = red
key                     = Coverage from RNA-Seq
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#This track does not work correctly. A scale with and a few non-matching peeks are shown.
feature                 = coverage
glyph                   = wiggle_xyplot
database                = ovarysam
height                  = 50
fgcolor                 = black
bicolor_pivot           = 20
pos_color               = royalblue
neg_color               = red
key                     = Coverage ovary
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#Correct data is shown
feature        = match
glyph          = segments
database       = ovarysam
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bgcolor        = royalblue
fgcolor        = black
height         = 5
label density  = 50
feature_limit  = 5000
bump           = fast
connector      = solid
key            = RNA-Seq reads match ovary
category       = Experimental Data


Is there a method to verify the bam files are correct?
What could be causing the coverage track to be wrong?

Best Regards
Stefan Pfeiffer

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]

Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (                     216-392-3087
Ontario Institute for Cancer Research



Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]
Reply | Threaded
Open this post in threaded view

Re: Coverage track not working

Scott Cain
Hi Stefan,

Unfortunately, I don't have anything more to offer--my guess is that you are just particularly unlucky :-/

Have you considered making a bigwig of the coverage data?  In general, bigwig data work better and are more compact (though you don't get individual read data, so if you need that, then you'd have both the BAM and the bigwig file).


On Wed, May 31, 2017 at 12:01 PM, Stefan Pfeiffer <[hidden email]> wrote:

Hi Scott,

thank you for the suggestion. IGV does show the correct and expected coverage.
Zooming in GBrowse does not change anything.
You can see the result at

If it is helpful, we could also upload the bam file.
samtools view wrong_coverage.bam returns lines like the following.  The position/length integers in the 8th/9th column remain 0 throughout the entire file, which is not the case for correct_coverage.bam. Could this be the cause?

ILLUMINA-D0898A_0001:1:94:15808:4394#0/1        0       NW_015452213.1  1447    40      38M     *       0       0       TGTGGTACTCGTGTACACAGCAGAAGAATTATCAGTAT  bbbbbbbbbbbbbbbbbbabbbbbbbbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0
ILLUMINA-D0898A_0001:1:2:16831:1638#0/1 0       NW_015452213.1  1449    40      38M     *       0       0       TGGTACTCGTGTACACAGCAGAAGAATTATCAGTATAA  ]abbbbbbabaabbbbbbbbbbbbabbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0

Best Regards


On 2017-05-10 16:51, Scott Cain wrote:

Hi Stefan,
I know that there can be problems associated with sampling the bam data when drawing coverage plots. Have you tried zooming in and out to see if the coverage plot changes to look more "right".  Similarly, have you tried opening the bam file in other software like IGV to see if it looks right? 

On Mon, May 8, 2017 at 11:59 AM, Stefan Pfeiffer <[hidden email]> wrote:


I am working with two databases in my configuration file and need to display coverage tracks for both of them.
One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.

The track definitions for databases rnaseqall and ovarysam:

#This coverage track works
feature                 = coverage
glyph                   = wiggle_xyplot
database             = rnaseqall
height                  = 50
fgcolor                 = black
bicolor_pivot       = 20
pos_color             = royalblue
neg_color             = red
key                     = Coverage from RNA-Seq
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#This track does not work correctly. A scale with and a few non-matching peeks are shown.
feature                 = coverage
glyph                   = wiggle_xyplot
database                = ovarysam
height                  = 50
fgcolor                 = black
bicolor_pivot           = 20
pos_color               = royalblue
neg_color               = red
key                     = Coverage ovary
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#Correct data is shown
feature        = match
glyph          = segments
database       = ovarysam
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bgcolor        = royalblue
fgcolor        = black
height         = 5
label density  = 50
feature_limit  = 5000
bump           = fast
connector      = solid
key            = RNA-Seq reads match ovary
category       = Experimental Data


Is there a method to verify the bam files are correct?
What could be causing the coverage track to be wrong?

Best Regards
Stefan Pfeiffer

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]

Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (                     <a href="tel:(216)%20392-3087" value="+12163923087" target="_blank">216-392-3087
Ontario Institute for Cancer Research



Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (                     216-392-3087
Ontario Institute for Cancer Research

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]
Reply | Threaded
Open this post in threaded view

Re: Coverage track not working

Timothy Parnell
In reply to this post by Zipixx
Hi Stefan,

If I navigate to the link you provided below, and dump your bam file, I noticed that virtually all of the alignments are marked as “not primary alignment” (flag bit value of 256 or 272). In fact, only 36 alignments are marked as primary alignments. That can easily account for the sparse coverage in the coverage_xyplot graph.

Evidently the Bio::DB::Sam adapter coverage method employs a low level filter to skip non-primary alignments, which I never realized before. Low level as in this is not the Perl stuff but in either the XS code or the samtools C library.

In IGV, you can filter secondary alignments. It should recreate what you see in GBrowse. Considering Bio::DB::Sam has now been superseded by Bio::DB::HTS (which is not exactly a drop-in replacement), there’s not much you can do about this except to use bigWig generated by a different program.


On May 31, 2017, at 10:01 AM, Stefan Pfeiffer <[hidden email]<mailto:[hidden email]>> wrote:

Hi Scott,

thank you for the suggestion. IGV does show the correct and expected coverage.
Zooming in GBrowse does not change anything.
You can see the result at

If it is helpful, we could also upload the bam file.
samtools view wrong_coverage.bam returns lines like the following.  The position/length integers in the 8th/9th column remain 0 throughout the entire file, which is not the case for correct_coverage.bam. Could this be the cause?

ILLUMINA-D0898A_0001:1:94:15808:4394#0/1        0       NW_015452213.1  1447    40      38M     *       0       0       TGTGGTACTCGTGTACACAGCAGAAGAATTATCAGTAT  bbbbbbbbbbbbbbbbbbabbbbbbbbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0
ILLUMINA-D0898A_0001:1:2:16831:1638#0/1 0       NW_015452213.1  1449    40      38M     *       0       0       TGGTACTCGTGTACACAGCAGAAGAATTATCAGTATAA  ]abbbbbbabaabbbbbbbbbbbbabbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0

Best Regards

On 2017-05-10 16:51, Scott Cain wrote:

Hi Stefan,

I know that there can be problems associated with sampling the bam data when drawing coverage plots. Have you tried zooming in and out to see if the coverage plot changes to look more "right".  Similarly, have you tried opening the bam file in other software like IGV to see if it looks right?


On Mon, May 8, 2017 at 11:59 AM, Stefan Pfeiffer <[hidden email]<mailto:[hidden email]>> wrote:


I am working with two databases in my configuration file and need to display coverage tracks for both of them.
One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.

The track definitions for databases rnaseqall and ovarysam:

#This coverage track works
feature                 = coverage
glyph                   = wiggle_xyplot
database             = rnaseqall
height                  = 50
fgcolor                 = black
bicolor_pivot       = 20
pos_color             = royalblue
neg_color             = red
key                     = Coverage from RNA-Seq
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#This track does not work correctly. A scale with and a few non-matching peeks are shown.
feature                 = coverage
glyph                   = wiggle_xyplot
database                = ovarysam
height                  = 50
fgcolor                 = black
bicolor_pivot           = 20
pos_color               = royalblue
neg_color               = red
key                     = Coverage ovary
citation                = RNA-Seq reads combined from all developmental stages.
category                = RNA-Seq

#Correct data is shown
feature        = match
glyph          = segments
database       = ovarysam
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bgcolor        = royalblue
fgcolor        = black
height         = 5
label density  = 50
feature_limit  = 5000
bump           = fast
connector      = solid
key            = RNA-Seq reads match ovary
category       = Experimental Data

Is there a method to verify the bam files are correct?
What could be causing the coverage track to be wrong?

Best Regards
Stefan Pfeiffer

Check out the vibrant tech community on one of the world's most
engaging tech sites,<>!
Gmod-gbrowse mailing list
[hidden email]<mailto:[hidden email]>

Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (                     216-392-3087
Ontario Institute for Cancer Research

Check out the vibrant tech community on one of the world's most
engaging tech sites,<>!
Gmod-gbrowse mailing list
[hidden email]<mailto:[hidden email]>

Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]
Reply | Threaded
Open this post in threaded view

Re: Coverage track not working

Keiran Raine



We created a C program for generating bigwig files following the deprecation of Bio::DB::Sam.  This has the added advantage that you can select which read flags are used in the coverage calculations:


You can also use bam2bw in a per-chromosome mode (by sepecifying '--region') and then merge the data with bwjoin for faster turn around.  This is simplified using (part of PCAP-core) to handle the multiple threads and merging for you but that is a much larger install.




Keiran Raine

Principal Bioinformatician

Cancer Genome Project

Wellcome Trust Sanger Institute

[hidden email]

Tel:+44 (0)1223 834244 Ext: 4983

Office: H104


On 01/06/2017, 00:20, "Timothy Parnell" <[hidden email]> wrote:


    Hi Stefan,


    If I navigate to the link you provided below, and dump your bam file, I noticed that virtually all of the alignments are marked as “not primary alignment” (flag bit value of 256 or 272). In fact, only 36 alignments are marked as primary alignments. That can easily account for the sparse coverage in the coverage_xyplot graph.


    Evidently the Bio::DB::Sam adapter coverage method employs a low level filter to skip non-primary alignments, which I never realized before. Low level as in this is not the Perl stuff but in either the XS code or the samtools C library.


    In IGV, you can filter secondary alignments. It should recreate what you see in GBrowse. Considering Bio::DB::Sam has now been superseded by Bio::DB::HTS (which is not exactly a drop-in replacement), there’s not much you can do about this except to use bigWig generated by a different program.





    On May 31, 2017, at 10:01 AM, Stefan Pfeiffer <[hidden email]<mailto:[hidden email]>> wrote:



    Hi Scott,


    thank you for the suggestion. IGV does show the correct and expected coverage.

    Zooming in GBrowse does not change anything.

    You can see the result at


    If it is helpful, we could also upload the bam file.

    samtools view wrong_coverage.bam returns lines like the following.  The position/length integers in the 8th/9th column remain 0 throughout the entire file, which is not the case for correct_coverage.bam. Could this be the cause?


    ILLUMINA-D0898A_0001:1:94:15808:4394#0/1        0       NW_015452213.1  1447    40      38M     *       0       0       TGTGGTACTCGTGTACACAGCAGAAGAATTATCAGTAT  bbbbbbbbbbbbbbbbbbabbbbbbbbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0

    ILLUMINA-D0898A_0001:1:2:16831:1638#0/1 0       NW_015452213.1  1449    40      38M     *       0       0       TGGTACTCGTGTACACAGCAGAAGAATTATCAGTATAA  ]abbbbbbabaabbbbbbbbbbbbabbbbbbbbbbbbb  MD:Z:38 NH:i:1  HI:i:1  NM:i:0  SM:i:40 XQ:i:40 X2:i:0


    Best Regards





    On 2017-05-10 16:51, Scott Cain wrote:


    Hi Stefan,


    I know that there can be problems associated with sampling the bam data when drawing coverage plots. Have you tried zooming in and out to see if the coverage plot changes to look more "right".  Similarly, have you tried opening the bam file in other software like IGV to see if it looks right?





    On Mon, May 8, 2017 at 11:59 AM, Stefan Pfeiffer <[hidden email]<mailto:[hidden email]>> wrote:




    I am working with two databases in my configuration file and need to display coverage tracks for both of them.

    One works fine, the other does not. When using feature = match and glyph = segments however, the correct data is shown.


    The track definitions for databases rnaseqall and ovarysam:


    #This coverage track works


    feature                 = coverage

    glyph                   = wiggle_xyplot

    database             = rnaseqall

    height                  = 50

    fgcolor                 = black

    bicolor_pivot       = 20

    pos_color             = royalblue

    neg_color             = red

    key                     = Coverage from RNA-Seq

    citation                = RNA-Seq reads combined from all developmental stages.

    category                = RNA-Seq


    #This track does not work correctly. A scale with and a few non-matching peeks are shown.


    feature                 = coverage

    glyph                   = wiggle_xyplot

    database                = ovarysam

    height                  = 50

    fgcolor                 = black

    bicolor_pivot           = 20

    pos_color               = royalblue

    neg_color               = red

    key                     = Coverage ovary

    citation                = RNA-Seq reads combined from all developmental stages.

    category                = RNA-Seq


    #Correct data is shown


    feature        = match

    glyph          = segments

    database       = ovarysam

    draw_target    = 1

    show_mismatch  = 1

    mismatch_color = red

    bgcolor        = royalblue

    fgcolor        = black

    height         = 5

    label density  = 50

    feature_limit  = 5000

    bump           = fast

    connector      = solid

    key            = RNA-Seq reads match ovary

    category       = Experimental Data




    Is there a method to verify the bam files are correct?

    What could be causing the coverage track to be wrong?


    Best Regards

    Stefan Pfeiffer



    Check out the vibrant tech community on one of the world's most

    engaging tech sites,<>!


    Gmod-gbrowse mailing list

    [hidden email]<mailto:[hidden email]>






    Scott Cain, Ph. D.                                   scott at scottcain dot net

    GMOD Coordinator (                     216-392-3087

    Ontario Institute for Cancer Research




    Check out the vibrant tech community on one of the world's most

    engaging tech sites,<>!

    Gmod-gbrowse mailing list

    [hidden email]<mailto:[hidden email]>



    Check out the vibrant tech community on one of the world's most

    engaging tech sites,!


    Gmod-gbrowse mailing list

    [hidden email]


-- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE.
Check out the vibrant tech community on one of the world's most
engaging tech sites,!
Gmod-gbrowse mailing list
[hidden email]