Fwd: Errors with Blast engine and Fasta index

classic Classic list List threaded Threaded
5 messages Options
Reply | Threaded
Open this post in threaded view
|

Fwd: Errors with Blast engine and Fasta index

Isabel Marcelino

---------- Forwarded message ----------
From: Isabel Marcelino <[hidden email]>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: [hidden email]


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



Garanti sans virus. www.avast.com

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Errors with Blast engine and Fasta index

Ence,daniel
Hi Isabel, The warning is referring to an empty entry in one of the fasta files (“Warning: Sequence contains no data”). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry “NODE_1_length_465927_cov_94.9908”? 

~Daniel



On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <[hidden email]> wrote:


---------- Forwarded message ----------
From: Isabel Marcelino <[hidden email]>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: [hidden email]


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



Garanti sans virus. www.avast.com
<a href="x-msg://11/#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2" width="1" height="1" class="">
_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org


_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Fwd: Errors with Blast engine and Fasta index

Isabel Marcelino
Hi Daniel,
Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either...
Isabel

(PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help)

 (>NODE_1_length_465927_cov_94.9908
ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA
ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT
CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA
AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC
CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC
AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC
AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG
ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG
ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT
GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....)


On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote:
Hi Isabel, The warning is referring to an empty entry in one of the fasta files (“Warning: Sequence contains no data”). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry “NODE_1_length_465927_cov_94.9908”? 

~Daniel



On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">isabel.ma...@...> wrote:


---------- Forwarded message ----------
From: Isabel Marcelino <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">isabel.ma...@...>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: <a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">maker...@...


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



<a href="https://www.avast.com/sig-email?utm_medium=email&amp;utm_source=link&amp;utm_campaign=sig-email&amp;utm_content=webmail" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw&#39;;return true;" onclick="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw&#39;;return true;"> Garanti sans virus. <a href="https://www.avast.com/sig-email?utm_medium=email&amp;utm_source=link&amp;utm_campaign=sig-email&amp;utm_content=webmail" style="color:#4453ea" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw&#39;;return true;" onclick="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw&#39;;return true;"> www.avast.com
_______________________________________________
maker-devel mailing list
<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">maker...@....com
<a href="http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fbox290.bluehost.com%2Fmailman%2Flistinfo%2Fmaker-devel_yandell-lab.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGq2mnzxdSrCHo1Oh5DlYNb_emfZw&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fbox290.bluehost.com%2Fmailman%2Flistinfo%2Fmaker-devel_yandell-lab.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGq2mnzxdSrCHo1Oh5DlYNb_emfZw&#39;;return true;">http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org


_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Errors with Blast engine and Fasta index

Carson Holt-2
In reply to this post by Ence,daniel
It can also be that your temporary directory became full at one point or you set TMP= to a location that is not a local disk (i.e. set it to a network mounted storage location). The fasta index is based off of BerkleyDB which has issues if run of of network storage. In any case just restart, and it will probably get past the error on the retry.

—Carson



On Aug 23, 2017, at 10:57 AM, Ence,daniel <[hidden email]> wrote:

Hi Isabel, The warning is referring to an empty entry in one of the fasta files (“Warning: Sequence contains no data”). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry “NODE_1_length_465927_cov_94.9908”? 

~Daniel



On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <[hidden email]> wrote:


---------- Forwarded message ----------
From: Isabel Marcelino <[hidden email]>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: [hidden email]


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



Garanti sans virus. www.avast.com
<a href="x-msg://11/#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2" width="1" height="1" class="">
_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org


_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Errors with Blast engine and Fasta index

Ence,daniel
In reply to this post by Isabel Marcelino
Hi Isabel, if the issue isn’t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc. 

~Daniel


On Aug 23, 2017, at 1:38 PM, Isabel Marcelino <[hidden email]> wrote:

Hi Daniel,
Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either...
Isabel

(PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help)

 (>NODE_1_length_465927_cov_94.9908
ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA
ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT
CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA
AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC
CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC
AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC
AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG
ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG
ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT
GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....)


On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote:
Hi Isabel, The warning is referring to an empty entry in one of the fasta files (“Warning: Sequence contains no data”). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry “NODE_1_length_465927_cov_94.9908”? 

~Daniel



On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class="">isabel.ma...@...> wrote:


---------- Forwarded message ----------
From: Isabel Marcelino <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class="">isabel.ma...@...>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: <a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class=""> maker...@...


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



<a href="https://www.avast.com/sig-email?utm_medium=email&amp;utm_source=link&amp;utm_campaign=sig-email&amp;utm_content=webmail" target="_blank" rel="nofollow" onmousedown="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw';return true;" onclick="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw';return true;" class=""> Garanti sans virus. <a href="https://www.avast.com/sig-email?utm_medium=email&amp;utm_source=link&amp;utm_campaign=sig-email&amp;utm_content=webmail" style="color:#4453ea" target="_blank" rel="nofollow" onmousedown="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw';return true;" onclick="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fwww.avast.com%2Fsig-email%3Futm_medium%3Demail%26utm_source%3Dlink%26utm_campaign%3Dsig-email%26utm_content%3Dwebmail\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFuftbSgu95389HmI-4V1nVL3tGJw';return true;" class=""> www.avast.com
_______________________________________________
maker-devel mailing list
<a href="javascript:" target="_blank" gdf-obfuscated-mailto="40Fw3XjPCAAJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class="">maker...@....com
<a href="http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fbox290.bluehost.com%2Fmailman%2Flistinfo%2Fmaker-devel_yandell-lab.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGq2mnzxdSrCHo1Oh5DlYNb_emfZw';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fbox290.bluehost.com%2Fmailman%2Flistinfo%2Fmaker-devel_yandell-lab.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGq2mnzxdSrCHo1Oh5DlYNb_emfZw';return true;" class="">http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org


_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org