[Fwd: Retrieving sequences]

classic Classic list List threaded Threaded
1 message Options
Reply | Threaded
Open this post in threaded view
|

[Fwd: Retrieving sequences]

J.M.P. Alves
Hi,

Has anyone come across this behavior, or is this as intended?

I have an instance of GBrowse 2 with contigs and ESTs (result of BLASTN
alignment) loaded. The details page show the alignments nicely in the
matches part.

But there is a possible problem -- and a question.

Here's the beginning of the alignment, with the contig sequence
(reference) on top and the EST (query) on the bottom:
TRA_g1_contig06086 18607
GTTCTCACGGGCATTCTGTAG-AAACAAACTCAGTACTCGGTAATACCCTTCCCACGGCA 18549
|||||||||||||||||| |  |||||||||||| |||||||||||||||||||||||||
gi|218981313|gb|FG238296.1|FG238296    29
GTTCTCACGGGCATTCTGCATCAAACAAACTCAGCACTCGGTAATACCCTTCCCACGGCA 88

I double checked and this is correct, that is indeed the EST's sequence.

And here is the beginning of the sequence given at the bottom of the
details page:
>gi|218981313|gb|FG238296.1|FG238296 class=Sequence
position=TRA_g1_contig06086:18289..18607 (- strand)
GTTCTCACGG GCATTCTGTA GAAACAAACT CAGTACTCGG TAATACCCTT CCCACGGCAG
CGCTGCCGCC AAGGCCGCCA

As you might be able to see, the sequence at the bottom of the page, in
spite of having the query's identifier, is actually the sequence
corresponding to the reference.

Another question: how do I access the query sequence directly, e.g. to
download the whole EST and not just see the aligned part (by using a
link in a balloon, probably, but if it displays in the details page
that's fine too)?

Thanks in advance
J

--
-------------------------------
João Marcelo Pereira Alves (J)
MCV / VCU - Richmond, VA
http://bioinfo.lpb.mic.vcu.edu
f. 1-804-828-3897


------------------------------------------------------------------------------
This SF.net email is sponsored by

Make an app they can't live without
Enter the BlackBerry Developer Challenge
http://p.sf.net/sfu/RIM-dev2dev 
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse