GC content and 6 frame translation

classic Classic list List threaded Threaded
8 messages Options
Reply | Threaded
Open this post in threaded view
|

GC content and 6 frame translation

celia
Hello,

I follow all the step to include the GC content and 6 frame translation in
my browser
http://www.livestockgenomics.csiro.au/gbrowse2/tutorial/tutorial.html

but no data are added to it...

I add all the right for the databases folder

drwxrwsrwx 8 xxx apache        4096 Mar  3 18:36 databases/

the file species.fa is on the database, the chromosomes have the same names
as in the gff3 file

species.gff3
ctg68   Soap    contig  1       906813  .       .       .       ID=ctg68;
Name=ctg68

species.fa
>ctg122
ACTCTTGATACCTCAATATTCACACCCTACTGGGCTACGCTTAACATAACTGTTTTATCT
CCACATCCATTACTAAACTCAAGACAACTCATTTTTTACTGCCTTGAAACATACTACACC
TCATTATACTCATGATCTCAAATATAAACAATACATAACCTCCCCTCCACCTGACCACAC

the index file is not created by gbrowse so I may have a problem somewhere
but I do not know where, if someone can help me

thank you

celia





--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3409916.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

J.M.P. Alves
Hi,

What exactly do you get? A blank area where the GC and 6-frame should
have been, or something weird like the attached picture? (an error
message plus part of the sequence)

I got that when I received a file that was generated on a Mac, and
therefore had bad end of line termination. After fixing that and
reloading it to the database, things got back to normal.

If you are getting a blank area, then I don't know exactly what is going
on without further investigation and details (e.g. are you using memory
databases or relational, etc.).

J

celia wrote:

> Hello,
>
> I follow all the step to include the GC content and 6 frame translation in
> my browser
> http://www.livestockgenomics.csiro.au/gbrowse2/tutorial/tutorial.html
>
> but no data are added to it...
>
> I add all the right for the databases folder
>
> drwxrwsrwx 8 xxx apache        4096 Mar  3 18:36 databases/
>
> the file species.fa is on the database, the chromosomes have the same names
> as in the gff3 file
>
> species.gff3
> ctg68   Soap    contig  1       906813  .       .       .       ID=ctg68;
> Name=ctg68
>
> species.fa
>> ctg122
> ACTCTTGATACCTCAATATTCACACCCTACTGGGCTACGCTTAACATAACTGTTTTATCT
> CCACATCCATTACTAAACTCAAGACAACTCATTTTTTACTGCCTTGAAACATACTACACC
> TCATTATACTCATGATCTCAAATATAAACAATACATAACCTCCCCTCCACCTGACCACAC
>
> the index file is not created by gbrowse so I may have a problem somewhere
> but I do not know where, if someone can help me
>
> thank you
>
> celia
>
>
>
>
>
> --
> View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3409916.html
> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
>
> ------------------------------------------------------------------------------
> What You Don't Know About Data Connectivity CAN Hurt You
> This paper provides an overview of data connectivity, details
> its effect on application quality, and explores various alternative
> solutions. http://p.sf.net/sfu/progress-d2d
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
--
-------------------------------
João Marcelo Pereira Alves (J)
Post-doctoral fellow
MCV / VCU - Richmond, VA
http://bioinfo.lpb.mic.vcu.edu
f. 1-804-828-3897


------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Screenshot.png (20K) Download Attachment
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

celia
Thank you for your answer,

Nothing is displayed , the GC content and the 6 frame title are diplayed but
no data

http://generic-model-organism-system-database.450254.n5.nabble.com/file/n3412890/Screenshot.png 

as you can see in the screenshot. and the index file is not created in the
database folder

I am using  Bio::DB::GFF database

thank you for your help

celia




--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3412890.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

celia
I found why it was not working, I switch to db_adaptor    =
Bio::DB::SeqFeature::Store as Bio::DB::GFF database  can only read gff files

and the index file is created in the databases folder, so it should work

but now my mysql database is not recognized... :/

mysql can not work with Bio::DB::SeqFeature::Store as Bio::DB::GFF??

celia

--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3413194.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

Scott Cain
Hi Celia,

How did you load your mysql database?  That will determine what
database adaptor to use.  If you used bp_load_gff.pl,
bp_bulk_load_gff.pl or bp_fast_load_gff.pl, you need to use
Bio::DB::GFF.  If you used bp_seqfeature_load.pl, you need to use
Bio::DB::SeqFeature::Store (this is the best option for GFF3).

Scott


On Mon, Mar 7, 2011 at 4:46 PM, celia <[hidden email]> wrote:

> I found why it was not working, I switch to db_adaptor    =
> Bio::DB::SeqFeature::Store as Bio::DB::GFF database  can only read gff files
>
> and the index file is created in the databases folder, so it should work
>
> but now my mysql database is not recognized... :/
>
> mysql can not work with Bio::DB::SeqFeature::Store as Bio::DB::GFF??
>
> celia
>
> --
> View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3413194.html
> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
>
> ------------------------------------------------------------------------------
> What You Don't Know About Data Connectivity CAN Hurt You
> This paper provides an overview of data connectivity, details
> its effect on application quality, and explores various alternative
> solutions. http://p.sf.net/sfu/progress-d2d
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

celia
I used bp_bulk_load_gff.pl

I just figure out that this script takes a --fasta argument to load raw DNA
into the database as well.  so I add the fasta args

[scaffolds:database]
db_adaptor      = Bio::DB::GFF
db_args         = -adaptor dbi::mysql
                  -dir /var/www/html/gbrowse2/databases/Sbayanus
                  -dsn   dbi:mysql:database=yeast;host=localhost
                  -fasta /var/www/html/gbrowse2/databases/Sbayanus
                  -user  me


and I load the fasta file
umask 0002 && bp_load_gff.pl --dsn "database"  --user me  -f
/var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta
Loading fasta file /var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta
/var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta: 147 records loaded

but still nothing

rha I am sure I am close ;)


--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3413310.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

celia
thank you for your help!

In fact it is working, but I may still have a bug because I have no image
under 5kb...

--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3413357.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
What You Don't Know About Data Connectivity CAN Hurt You
This paper provides an overview of data connectivity, details
its effect on application quality, and explores various alternative
solutions. http://p.sf.net/sfu/progress-d2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: GC content and 6 frame translation

Scott Cain
In reply to this post by celia
Hi Celia,

If you loaded the DNA into the database, you should not be providing a
"dir" or "fasta" argument, because that would be telling GBrowse to
look in a directory for fasta data, when it should really be looking
in the database.  I'm not sure if this has anything to do with why you
aren't seeing an image below 5kb though.  Is there anything in the
error_log?

Scott


On Mon, Mar 7, 2011 at 6:42 PM, celia <[hidden email]> wrote:

> I used bp_bulk_load_gff.pl
>
> I just figure out that this script takes a --fasta argument to load raw DNA
> into the database as well.  so I add the fasta args
>
> [scaffolds:database]
> db_adaptor      = Bio::DB::GFF
> db_args         = -adaptor dbi::mysql
>                  -dir /var/www/html/gbrowse2/databases/Sbayanus
>                  -dsn   dbi:mysql:database=yeast;host=localhost
>                  -fasta /var/www/html/gbrowse2/databases/Sbayanus
>                  -user  me
>
>
> and I load the fasta file
> umask 0002 && bp_load_gff.pl --dsn "database"  --user me  -f
> /var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta
> Loading fasta file /var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta
> /var/www/html/gbrowse2/databases/Sbayanus/Sbayanus.fasta: 147 records loaded
>
> but still nothing
>
> rha I am sure I am close ;)
>
>
> --
> View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/GC-content-and-6-frame-translation-tp3409916p3413310.html
> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
>
> ------------------------------------------------------------------------------
> What You Don't Know About Data Connectivity CAN Hurt You
> This paper provides an overview of data connectivity, details
> its effect on application quality, and explores various alternative
> solutions. http://p.sf.net/sfu/progress-d2d
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Colocation vs. Managed Hosting
A question and answer guide to determining the best fit
for your organization - today and in the future.
http://p.sf.net/sfu/internap-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse