Gbrowse_syn sequence name

classic Classic list List threaded Threaded
1 message Options
Reply | Threaded
Open this post in threaded view
|

Gbrowse_syn sequence name

LE CAVORZIN Arnaud

I’m trying to load an alignment file into a mysql database, like describe in the tutorial.

 

My alignment file looks like :

 

CLUSTAL W(1.81) multiple sequence alignment W(1.81)

SpA-1(+)/1..231239   --------------------------------------------------

SpB-1(+)/1..231239   CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC

 

SpA-1(+)/1..231239   --------------------------------------------------

SpB-1(+)/1..231239   CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG

 

 

When using gbrowse_syn_load_alignments_msa.pl I have an error saying “I do not like the sequence name”. I have tried to change the name, but even if I used the same name as the tutorial I have the same error.

What I could do to import these data?

 

 

Thank you for your answer,

 

 

Best regards

 

 

 

Arnaud


------------------------------------------------------------------------------

_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse