Is there a way to export insertions and substitutions as residues and/or seq attributes in Apollo1?

classic Classic list List threaded Threaded
3 messages Options
Reply | Threaded
Open this post in threaded view
|

Is there a way to export insertions and substitutions as residues and/or seq attributes in Apollo1?

Monica Poelchau
Hi there,

We'd like to export the 'residues' and/or 'seq' attributes that are generated for insertions and substitutions (sequence modifications) in Web Apollo 1.0.4 using the 'File->Export->gff3' menu.  (This is already possible when you select 'Reference Sequence -> Save track data'). I modified gff3_config.xml to accommodate these attributes (see attached example file), but my modifications don't appear to be recognized by the program - the exported gff3 still doesn't contain the attributes in appropriate gff3 line. (I know that the changed config is read by the program, though, because I also changed the source column value between versions, and this update was shown in the exported gff3 file).

Is there something I'm missing? Is this configurable in Apollo2?

On a related note - what was the decision behind using 'residues' *and* 'seq' for the export, as opposed to one or the other? Are there contexts within Apollo in which the value of one would differ from the other?

Thanks again for your help!

Monica




This list is for the Apollo Annotation Editing Tool. Info at http://genomearchitect.org/
If you wish to unsubscribe from the Apollo List: 1. From the address with which you subscribed to the list, send a message to [hidden email] | 2. In the subject line of your email type: unsubscribe apollo | 3. Leave the message body blank.


gff3_config.xml (1K) Download Attachment
Reply | Threaded
Open this post in threaded view
|

Re: Is there a way to export insertions and substitutions as residues and/or seq attributes in Apollo1?

nathandunn

> On Dec 29, 2015, at 10:16 AM, Monica Poelchau <[hidden email]> wrote:
>
> Hi there,
>
> We'd like to export the 'residues' and/or 'seq' attributes that are generated for insertions and substitutions (sequence modifications) in Web Apollo 1.0.4 using the 'File->Export->gff3' menu.  (This is already possible when you select 'Reference Sequence -> Save track data'). I modified gff3_config.xml to accommodate these attributes (see attached example file), but my modifications don't appear to be recognized by the program - the exported gff3 still doesn't contain the attributes in appropriate gff3 line. (I know that the changed config is read by the program, though, because I also changed the source column value between versions, and this update was shown in the exported gff3 file).
>
> Is there something I'm missing?

Those attributes aren’t available for export.   Its pretty much what is in the list minus what you removed.

The reference sequence export has a different base-class and method that uses JBrowse directly instead of Apollo.

> Is this configurable in Apollo2?

If you create a GitHub issue we can definitely make that happen.  

My preference would to just add a “residue” (or something similar) tag for the implied deleted, substituted, or inserted elements.   Someone else may have a different preference.  

Right now you will only see the residue when exported as a GFF3 / FASTA as below:

. . .
###
Group1.1 . insertion 325462 325462 . + . Name=512cd82d-6179-4c8d-b3b6-82c8360ecab1-insertion;date_creation=2015-11-23;Owner=[hidden email];ID=512cd82d-6179-4c8d-b3b6-82c8360ecab1;date_last_modified=2015-11-23
###
Group1.1 . deletion 325442 325445 . + . Name=928ebb4c-87f9-4633-ba2e-69eb35579f4e-deletion;date_creation=2015-11-23;Owner=[hidden email];ID=928ebb4c-87f9-4633-ba2e-69eb35579f4e;date_last_modified=2015-11-23
###
Group1.1 . substitution 325483 325490 . + . Name=5bd42e13-bb73-44ec-b6cc-0f64b6b69933-substitution;date_creation=2015-11-23;Owner=[hidden email];ID=5bd42e13-bb73-44ec-b6cc-0f64b6b69933;date_last_modified=2015-11-23
. . . .
###
##FASTA
>Group1.1
AAAATACATCACAATACATTTAATTCACTTTCCATCATCGAGATTAACGAAAATTATTTA
AAATATCGAAGATGAAAATATCCTCAAGATGATACTGAACGGCTAAGAAAAATACATCAC
ACAACTTTAATTCATTTTCCATCATCGAGATTAACGAAAAGAAAAAATTTTAACTCCCTA
. . .
>512cd82d-6179-4c8d-b3b6-82c8360ecab1-insertion
ATATATATA
>928ebb4c-87f9-4633-ba2e-69eb35579f4e-deletion
TCTC
>5bd42e13-bb73-44ec-b6cc-0f64b6b69933-substitution
ATAGGGTA

> On a related note - what was the decision behind using 'residues' *and* 'seq' for the export, as opposed to one or the other? Are there contexts within Apollo in which the value of one would differ from the other?

I am not seeing anything obvious in the code.  

Nathan

>
> Thanks again for your help!
>
> Monica
> <gff3_config.xml>
>
>
> This list is for the Apollo Annotation Editing Tool. Info at http://genomearchitect.org/
> If you wish to unsubscribe from the Apollo List: 1. From the address with which you subscribed to the list, send a message to [hidden email] | 2. In the subject line of your email type: unsubscribe apollo | 3. Leave the message body blank.
>





This list is for the Apollo Annotation Editing Tool. Info at http://genomearchitect.org/
If you wish to unsubscribe from the Apollo List: 1. From the address with which you subscribed to the list, send a message to [hidden email] | 2. In the subject line of your email type: unsubscribe apollo | 3. Leave the message body blank.

Reply | Threaded
Open this post in threaded view
|

Re: Is there a way to export insertions and substitutions as residues and/or seq attributes in Apollo1?

Monica Poelchau
Ah, thanks for clarifying. I'll submit a ticket!

Monica

On Tue, Dec 29, 2015 at 11:18 PM, Nathan Dunn <[hidden email]> wrote:

> On Dec 29, 2015, at 10:16 AM, Monica Poelchau <[hidden email]> wrote:
>
> Hi there,
>
> We'd like to export the 'residues' and/or 'seq' attributes that are generated for insertions and substitutions (sequence modifications) in Web Apollo 1.0.4 using the 'File->Export->gff3' menu.  (This is already possible when you select 'Reference Sequence -> Save track data'). I modified gff3_config.xml to accommodate these attributes (see attached example file), but my modifications don't appear to be recognized by the program - the exported gff3 still doesn't contain the attributes in appropriate gff3 line. (I know that the changed config is read by the program, though, because I also changed the source column value between versions, and this update was shown in the exported gff3 file).
>
> Is there something I'm missing?

Those attributes aren’t available for export.   Its pretty much what is in the list minus what you removed.

The reference sequence export has a different base-class and method that uses JBrowse directly instead of Apollo.

> Is this configurable in Apollo2?

If you create a GitHub issue we can definitely make that happen.

My preference would to just add a “residue” (or something similar) tag for the implied deleted, substituted, or inserted elements.   Someone else may have a different preference.

Right now you will only see the residue when exported as a GFF3 / FASTA as below:

. . .
###
Group1.1        .       insertion       325462  325462  .       +       .       Name=512cd82d-6179-4c8d-b3b6-82c8360ecab1-insertion;date_creation=2015-11-23;Owner=[hidden email];ID=512cd82d-6179-4c8d-b3b6-82c8360ecab1;date_last_modified=2015-11-23
###
Group1.1        .       deletion        325442  325445  .       +       .       Name=928ebb4c-87f9-4633-ba2e-69eb35579f4e-deletion;date_creation=2015-11-23;Owner=[hidden email];ID=928ebb4c-87f9-4633-ba2e-69eb35579f4e;date_last_modified=2015-11-23
###
Group1.1        .       substitution    325483  325490  .       +       .       Name=5bd42e13-bb73-44ec-b6cc-0f64b6b69933-substitution;date_creation=2015-11-23;Owner=[hidden email];ID=5bd42e13-bb73-44ec-b6cc-0f64b6b69933;date_last_modified=2015-11-23
. . . .
###
##FASTA
>Group1.1
AAAATACATCACAATACATTTAATTCACTTTCCATCATCGAGATTAACGAAAATTATTTA
AAATATCGAAGATGAAAATATCCTCAAGATGATACTGAACGGCTAAGAAAAATACATCAC
ACAACTTTAATTCATTTTCCATCATCGAGATTAACGAAAAGAAAAAATTTTAACTCCCTA
. . .
>512cd82d-6179-4c8d-b3b6-82c8360ecab1-insertion
ATATATATA
>928ebb4c-87f9-4633-ba2e-69eb35579f4e-deletion
TCTC
>5bd42e13-bb73-44ec-b6cc-0f64b6b69933-substitution
ATAGGGTA

> On a related note - what was the decision behind using 'residues' *and* 'seq' for the export, as opposed to one or the other? Are there contexts within Apollo in which the value of one would differ from the other?

I am not seeing anything obvious in the code.

Nathan

>
> Thanks again for your help!
>
> Monica
> <gff3_config.xml>
>
>
> This list is for the Apollo Annotation Editing Tool. Info at http://genomearchitect.org/
> If you wish to unsubscribe from the Apollo List: 1. From the address with which you subscribed to the list, send a message to [hidden email] | 2. In the subject line of your email type: unsubscribe apollo | 3. Leave the message body blank.
>






This list is for the Apollo Annotation Editing Tool. Info at http://genomearchitect.org/
If you wish to unsubscribe from the Apollo List: 1. From the address with which you subscribed to the list, send a message to [hidden email] | 2. In the subject line of your email type: unsubscribe apollo | 3. Leave the message body blank.