Maker producing invalid gff3 files

classic Classic list List threaded Threaded
7 messages Options
Reply | Threaded
Open this post in threaded view
|

Maker producing invalid gff3 files

filipegoncalo
Hi again,

I am using Maker to study prokaryotic genomes. Then i want to visualize the .gff information with Apollo, and then to introduce it on my chado database.
I've realized that Maker is producing invalid gff files, which means that i am not obtaining correct results on Apollo, and therefore i am not able neither, to introduce properly data into my database.
Does anyone knows what might be happening?
I have googled it, but i am not  finding answer to my problem...

Thanks in advance,
Filipe

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

Carson Hinton Holt
Re: [maker-devel] Maker producing invalid gff3 files Could you send me an example of MAKER’s output you ae getting?  I do not get the same error.

Thanks,
Carson


On 7/1/11 6:18 AM, "Filipe Bregieiro" <filipegoncalo.duarte@...> wrote:

Hi again,

I am using Maker to study prokaryotic genomes. Then i want to visualize the .gff information with Apollo, and then to introduce it on my chado database.
I've realized that Maker is producing invalid gff files, which means that i am not obtaining correct results on Apollo, and therefore i am not able neither, to introduce properly data into my database.
Does anyone knows what might be happening?
I have googled it, but i am not  finding answer to my problem...

Thanks in advance,
Filipe


Carson Holt
Graduate Student
Yandell Lab
http:/www.yandell-lab.org/
Eccles Institute of Human Genetics
University of Utah

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

Carson Hinton Holt
In reply to this post by filipegoncalo
Re: [maker-devel] Maker producing invalid gff3 files No. the GFF3 is valid.  Apollo opens it correctly, and the SO validator validates it (available from SO).  http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online stalls when trying to download the SO ontology file, and thus never completes its validation.  How are you trying to load this into Chado?  Which script are you using?  This appears that it is more likely something during your load into the database.  The script for loading GFF3 into chado can be a bit tricky, and can actually require you to split GFF3 files into 3 separate loads.  One for sequences and contigs, one for genes, and one for evidence.  I have added a script to MAKER called maker2chado that helps handle these weird splitting issues, you might want to try it.  You will actually have to start from a new, empty Chado database because it can sometimes be difficult to recover from Chado database loading errors.  If you can provide more detail of the loading process you are using, I can try and help.  

Thanks,
Carson

On 7/1/11 6:18 AM, "Filipe Bregieiro" <filipegoncalo.duarte@...> wrote:

Hi again,

I am using Maker to study prokaryotic genomes. Then i want to visualize the .gff information with Apollo, and then to introduce it on my chado database.
I've realized that Maker is producing invalid gff files, which means that i am not obtaining correct results on Apollo, and therefore i am not able neither, to introduce properly data into my database.
Does anyone knows what might be happening?
I have googled it, but i am not  finding answer to my problem...

Thanks in advance,
Filipe


Carson Holt
Graduate Student
Yandell Lab
http:/www.yandell-lab.org/
Eccles Institute of Human Genetics
University of Utah

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

Carson Hinton Holt
In reply to this post by filipegoncalo
Re: [maker-devel] Maker producing invalid gff3 files Yes. The http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online validator is broken (appears to have issues after trying to load ontologies).  I verified this be producing a 5 line GFF3 file (no features or genes, just the contig).

##gff-version 3
test   .       contig  1       31220   .       .       .       ID=test;Name=test;
##FASTA
>test
TTTATTTAAATTTTTTTGATTATTAACAAAATCGGCAAAATAATCCACAGCGTTGTGTAA


I’ll contact Scott Cain and let him know (although I think he follows the MAKER list and may read it anyways).

--Carson



On 7/1/11 6:35 AM, "Filipe Bregieiro" <filipegoncalo.duarte@...> wrote:

I've just noticed i have an error on my maker_opts.ctl, on my last email. But anway with other tests, with evrything correct the gff turns to be invalid

2011/7/1 Filipe Bregieiro <filipegoncalo.duarte@...>
I suppose you mean the gff file... 
I've tested it just now with a small sample from a genome. I'll attach it here  then.

Thank you!
Filipe


2011/7/1 Carson Holt <carson.holt@...>
Could you send me an example of MAKER’s output you ae getting?  I do not get the same error.

Thanks,
Carson



On 7/1/11 6:18 AM, "Filipe Bregieiro" <filipegoncalo.duarte@... <http://filipegoncalo.duarte@...> > wrote:

Hi again,

I am using Maker to study prokaryotic genomes. Then i want to visualize the .gff information with Apollo, and then to introduce it on my chado database.
I've realized that Maker is producing invalid gff files, which means that i am not obtaining correct results on Apollo, and therefore i am not able neither, to introduce properly data into my database.
Does anyone knows what might be happening?
I have googled it, but i am not  finding answer to my problem...

Thanks in advance,
Filipe


Carson Holt
Graduate Student
Yandell Lab
http:/www.yandell-lab.org/
Eccles Institute of Human Genetics
University of Utah




Carson Holt
Graduate Student
Yandell Lab
http:/www.yandell-lab.org/
Eccles Institute of Human Genetics
University of Utah

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

Scott Cain
Hi Carson,

Thanks for letting me know--I'll poke the owner of that machine.

Scott


On Fri, Jul 1, 2011 at 8:58 AM, Carson Holt
<[hidden email]> wrote:

> Yes. The http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online validator
> is broken (appears to have issues after trying to load ontologies).  I
> verified this be producing a 5 line GFF3 file (no features or genes, just
> the contig).
>
> ##gff-version 3
> test   .       contig  1       31220   .       .       .
>       ID=test;Name=test;
> ##FASTA
>>test
> TTTATTTAAATTTTTTTGATTATTAACAAAATCGGCAAAATAATCCACAGCGTTGTGTAA
>
>
> I’ll contact Scott Cain and let him know (although I think he follows the
> MAKER list and may read it anyways).
>
> --Carson
>
>
>
> On 7/1/11 6:35 AM, "Filipe Bregieiro" <[hidden email]>
> wrote:
>
> I've just noticed i have an error on my maker_opts.ctl, on my last email.
> But anway with other tests, with evrything correct the gff turns to be
> invalid
>
> 2011/7/1 Filipe Bregieiro <[hidden email]>
>
> I suppose you mean the gff file...
> I've tested it just now with a small sample from a genome. I'll attach it
> here  then.
>
> Thank you!
> Filipe
>
>
> 2011/7/1 Carson Holt <[hidden email]>
>
> Could you send me an example of MAKER’s output you ae getting?  I do not get
> the same error.
>
> Thanks,
> Carson
>
>
>
> On 7/1/11 6:18 AM, "Filipe Bregieiro" <[hidden email]
> <http://filipegoncalo.duarte@...> > wrote:
>
> Hi again,
>
> I am using Maker to study prokaryotic genomes. Then i want to visualize the
> .gff information with Apollo, and then to introduce it on my chado database.
> I've realized that Maker is producing invalid gff files, which means that i
> am not obtaining correct results on Apollo, and therefore i am not able
> neither, to introduce properly data into my database.
> Does anyone knows what might be happening?
> I have googled it, but i am not  finding answer to my problem...
>
> Thanks in advance,
> Filipe
>
>
> Carson Holt
> Graduate Student
> Yandell Lab
> http:/www.yandell-lab.org/
> Eccles Institute of Human Genetics
> University of Utah
>
>
>
>
> Carson Holt
> Graduate Student
> Yandell Lab
> http:/www.yandell-lab.org/
> Eccles Institute of Human Genetics
> University of Utah
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

Scott Cain
Hi Carson and Filipe,

It just worked for me, though it didn't like Carson's sample GFF (the
trailing semicolon is a problem for it apparently).  It does take a
while at the ontology step, because every single time you run it, it
fetches the obo file and parses it, so you have to wait for that to
happen.

Scott



On Fri, Jul 1, 2011 at 9:17 AM, Scott Cain <[hidden email]> wrote:

> Hi Carson,
>
> Thanks for letting me know--I'll poke the owner of that machine.
>
> Scott
>
>
> On Fri, Jul 1, 2011 at 8:58 AM, Carson Holt
> <[hidden email]> wrote:
>> Yes. The http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online validator
>> is broken (appears to have issues after trying to load ontologies).  I
>> verified this be producing a 5 line GFF3 file (no features or genes, just
>> the contig).
>>
>> ##gff-version 3
>> test   .       contig  1       31220   .       .       .
>>       ID=test;Name=test;
>> ##FASTA
>>>test
>> TTTATTTAAATTTTTTTGATTATTAACAAAATCGGCAAAATAATCCACAGCGTTGTGTAA
>>
>>
>> I’ll contact Scott Cain and let him know (although I think he follows the
>> MAKER list and may read it anyways).
>>
>> --Carson
>>
>>
>>
>> On 7/1/11 6:35 AM, "Filipe Bregieiro" <[hidden email]>
>> wrote:
>>
>> I've just noticed i have an error on my maker_opts.ctl, on my last email.
>> But anway with other tests, with evrything correct the gff turns to be
>> invalid
>>
>> 2011/7/1 Filipe Bregieiro <[hidden email]>
>>
>> I suppose you mean the gff file...
>> I've tested it just now with a small sample from a genome. I'll attach it
>> here  then.
>>
>> Thank you!
>> Filipe
>>
>>
>> 2011/7/1 Carson Holt <[hidden email]>
>>
>> Could you send me an example of MAKER’s output you ae getting?  I do not get
>> the same error.
>>
>> Thanks,
>> Carson
>>
>>
>>
>> On 7/1/11 6:18 AM, "Filipe Bregieiro" <[hidden email]
>> <http://filipegoncalo.duarte@...> > wrote:
>>
>> Hi again,
>>
>> I am using Maker to study prokaryotic genomes. Then i want to visualize the
>> .gff information with Apollo, and then to introduce it on my chado database.
>> I've realized that Maker is producing invalid gff files, which means that i
>> am not obtaining correct results on Apollo, and therefore i am not able
>> neither, to introduce properly data into my database.
>> Does anyone knows what might be happening?
>> I have googled it, but i am not  finding answer to my problem...
>>
>> Thanks in advance,
>> Filipe
>>
>>
>> Carson Holt
>> Graduate Student
>> Yandell Lab
>> http:/www.yandell-lab.org/
>> Eccles Institute of Human Genetics
>> University of Utah
>>
>>
>>
>>
>> Carson Holt
>> Graduate Student
>> Yandell Lab
>> http:/www.yandell-lab.org/
>> Eccles Institute of Human Genetics
>> University of Utah
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
Reply | Threaded
Open this post in threaded view
|

Re: Maker producing invalid gff3 files

jim.hu.biobio
we really need to patch it to cache the file based on a session or timestamp.

We have one too, btw

http://ecolihub.net/cgi-bin/validate_gff3_online/validate_gff3_online

Sent from my iPad

On Jul 1, 2011, at 8:31 AM, Scott Cain <[hidden email]> wrote:

> Hi Carson and Filipe,
>
> It just worked for me, though it didn't like Carson's sample GFF (the
> trailing semicolon is a problem for it apparently).  It does take a
> while at the ontology step, because every single time you run it, it
> fetches the obo file and parses it, so you have to wait for that to
> happen.
>
> Scott
>
>
>
> On Fri, Jul 1, 2011 at 9:17 AM, Scott Cain <[hidden email]> wrote:
>> Hi Carson,
>>
>> Thanks for letting me know--I'll poke the owner of that machine.
>>
>> Scott
>>
>>
>> On Fri, Jul 1, 2011 at 8:58 AM, Carson Holt
>> <[hidden email]> wrote:
>>> Yes. The http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online validator
>>> is broken (appears to have issues after trying to load ontologies).  I
>>> verified this be producing a 5 line GFF3 file (no features or genes, just
>>> the contig).
>>>
>>> ##gff-version 3
>>> test   .       contig  1       31220   .       .       .
>>>       ID=test;Name=test;
>>> ##FASTA
>>>> test
>>> TTTATTTAAATTTTTTTGATTATTAACAAAATCGGCAAAATAATCCACAGCGTTGTGTAA
>>>
>>>
>>> I’ll contact Scott Cain and let him know (although I think he follows the
>>> MAKER list and may read it anyways).
>>>
>>> --Carson
>>>
>>>
>>>
>>> On 7/1/11 6:35 AM, "Filipe Bregieiro" <[hidden email]>
>>> wrote:
>>>
>>> I've just noticed i have an error on my maker_opts.ctl, on my last email.
>>> But anway with other tests, with evrything correct the gff turns to be
>>> invalid
>>>
>>> 2011/7/1 Filipe Bregieiro <[hidden email]>
>>>
>>> I suppose you mean the gff file...
>>> I've tested it just now with a small sample from a genome. I'll attach it
>>> here  then.
>>>
>>> Thank you!
>>> Filipe
>>>
>>>
>>> 2011/7/1 Carson Holt <[hidden email]>
>>>
>>> Could you send me an example of MAKER’s output you ae getting?  I do not get
>>> the same error.
>>>
>>> Thanks,
>>> Carson
>>>
>>>
>>>
>>> On 7/1/11 6:18 AM, "Filipe Bregieiro" <[hidden email]
>>> <http://filipegoncalo.duarte@...> > wrote:
>>>
>>> Hi again,
>>>
>>> I am using Maker to study prokaryotic genomes. Then i want to visualize the
>>> .gff information with Apollo, and then to introduce it on my chado database.
>>> I've realized that Maker is producing invalid gff files, which means that i
>>> am not obtaining correct results on Apollo, and therefore i am not able
>>> neither, to introduce properly data into my database.
>>> Does anyone knows what might be happening?
>>> I have googled it, but i am not  finding answer to my problem...
>>>
>>> Thanks in advance,
>>> Filipe
>>>
>>>
>>> Carson Holt
>>> Graduate Student
>>> Yandell Lab
>>> http:/www.yandell-lab.org/
>>> Eccles Institute of Human Genetics
>>> University of Utah
>>>
>>>
>>>
>>>
>>> Carson Holt
>>> Graduate Student
>>> Yandell Lab
>>> http:/www.yandell-lab.org/
>>> Eccles Institute of Human Genetics
>>> University of Utah
>>>
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D.                                   scott at scottcain dot net
>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>> Ontario Institute for Cancer Research
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>
> _______________________________________________
> maker-devel mailing list
> [hidden email]
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________
maker-devel mailing list
[hidden email]
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org