Re: No Gc content and six frame translation in GBrowse

classic Classic list List threaded Threaded
5 messages Options
Reply | Threaded
Open this post in threaded view
|

Re: No Gc content and six frame translation in GBrowse

Scott Cain
Hi Swetha,

Please ask questions like this on the gbrowse mailing list.

Did the directory.index file get created?  Is there anything in the apache error log that might point to a problem?  My first guess is a directory permission problem: the web server is unable the write in that directory.

Scott

Sent from my iPad

> On Apr 25, 2014, at 8:21 AM, [hidden email] wrote:
>
> Hello Sir,
>
> I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
>
> -Swetha.
>
>
> <quote author='Scott Cain'>
> Hi Eman,
>
> The most likely problem is that you tried to view the DNA and GC content
> before you added the fasta file.  When that happens, GBrowse will create
> the directory.index file with nothing in it.  GBrowse doesn't know that you
> added a fasta file after that, so it continues to think there is nothing
> there.  The fix is to delete the directory.index file and try again.
>
> Scott
>
>
>
>> On Mon, Jan 27, 2014 at 7:36 AM, EmanLee <[hidden email]> wrote:
>>
>> I have followed all the steps (include the GC content and 6 frame
>> translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
>> x86_64).
>> But, there are no "*GC content and 6 frame translation*" data displayed
>> as the snapscreen image.
>>
>>
>> We checked the following files:
>> (1)
>> apache error logs:
>> MSG: Got a sequence without letters. Could not guess alphabet, referer:
>> http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
>>
>> (2)
>> *ll /var/lib/gbrowse2/databases/*
>> drwxrwxrwx  2 root   root    4096 Jan 27 17:49 volvox
>>
>> *ll /var/lib/gbrowse2/databases/volvox*
>> -rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
>>
>> *wc directory.index *
>>    0     3 12288 directory.index
>>
>> (3)
>> We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
>> into /var/lib/gbrowse2/databases/volvox/
>>
>> (4)
>> we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
>> *more /var/lib/gbrowse2/databases/volvox/volvox.fa*
>>> ctgA
>> cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat
>> tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
>> ......
>>
>> (5)
>> *volvox.conf* in /etc/gbrowse2
>>
>> [GENERAL]
>> db_adaptor    = Bio::DB::SeqFeature::Store
>> db_args       = -adaptor memory
>>                -dir '/var/lib/gbrowse2/databases/volvox'
>> ......
>> [DNA]
>> glyph          = dna
>> global feature = 1
>> height         = 40
>> do_gc          = 1
>> gc_window      = auto
>> fgcolor        = red
>> axis_color     = blue
>> strand         = both
>> key            = DNA/GC Content
>> ......
>>
>> Thanks.
>> eman
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> WatchGuard Dimension instantly turns raw network data into actionable
>> security intelligence. It gives you real-time visual feedback on key
>> security issues and trends.  Skip the complicated setup - simply import
>> a virtual appliance and go from zero to informed in seconds.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>
> ------------------------------------------------------------------------------
> WatchGuard Dimension instantly turns raw network data into actionable
> security intelligence. It gives you real-time visual feedback on key
> security issues and trends.  Skip the complicated setup - simply import
> a virtual appliance and go from zero to informed in seconds.
> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> </quote>
> Quoted from:
> http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
>
>
> _____________________________________
> Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
>

------------------------------------------------------------------------------
Start Your Social Network Today - Download eXo Platform
Build your Enterprise Intranet with eXo Platform Software
Java Based Open Source Intranet - Social, Extensible, Cloud Ready
Get Started Now And Turn Your Intranet Into A Collaboration Platform
http://p.sf.net/sfu/ExoPlatform
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: No Gc content and six frame translation in GBrowse

rayapadi swetha
Dear Sir,

Thank you for your reply.

The Directory.index was not created in the database directory and I gave permission to the database directory. Even the restriction sites are not displaying after updating .conf file with "plugins     = TrackDumper Aligner RestrictionAnnotator". I attached the screenshot of the page for your reference.


The error log shows

[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] MSG: Could not open /var/lib/gbrowse2/databases/streptococcus: No such file or directory, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Error::throw, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Root::Root::throw /usr/local/share/perl5/Bio/Root/Root.pm:486, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_calc_termination_length /usr/local/share/perl5/Bio/DB/IndexedBase.pm:749, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_index_files /usr/local/share/perl5/Bio/DB/IndexedBase.pm:633, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::index_dir /usr/local/share/perl5/Bio/DB/IndexedBase.pm:446, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::new /usr/local/share/perl5/Bio/DB/IndexedBase.pm:361, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::commit /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:172, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::GFF3Loader::finish_load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:352, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load_fh /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:354, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::post_init /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:164, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::new /usr/local/share/perl5/Bio/DB/SeqFeature/Store.pm:395, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataBase::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm:44, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:997, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::default_dbid /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:1033, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::RegionSearch::init_databases /usr/local/lib64/perl5/Bio/Graphics/Browser2/RegionSearch.pm:125, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::get_search_object /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1234, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::PluginSet::configure /usr/local/lib64/perl5/Bio/Graphics/Browser2/PluginSet.pm:88, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::init_plugins /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1279, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Action::ACTION_retrieve_multiple /usr/local/lib64/perl5/Bio/Graphics/Browser2/Action.pm:282, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:430, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run_asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:359, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:277, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: /var/apache/cgi-bin/gb2/gbrowse:54, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] -----------------------------------------------------------, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/

Can you please fix this error and help me with this. Awaiting for your reply.

-Swetha Rayapadi



On Fri, Apr 25, 2014 at 8:31 PM, Scott Cain <[hidden email]> wrote:
Hi Swetha,

Please ask questions like this on the gbrowse mailing list.

Did the directory.index file get created?  Is there anything in the apache error log that might point to a problem?  My first guess is a directory permission problem: the web server is unable the write in that directory.

Scott

Sent from my iPad

> On Apr 25, 2014, at 8:21 AM, [hidden email] wrote:
>
> Hello Sir,
>
> I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
>
> -Swetha.
>
>
> <quote author='Scott Cain'>
> Hi Eman,
>
> The most likely problem is that you tried to view the DNA and GC content
> before you added the fasta file.  When that happens, GBrowse will create
> the directory.index file with nothing in it.  GBrowse doesn't know that you
> added a fasta file after that, so it continues to think there is nothing
> there.  The fix is to delete the directory.index file and try again.
>
> Scott
>
>
>
>> On Mon, Jan 27, 2014 at 7:36 AM, EmanLee <[hidden email]> wrote:
>>
>> I have followed all the steps (include the GC content and 6 frame
>> translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
>> x86_64).
>> But, there are no "*GC content and 6 frame translation*" data displayed
>> as the snapscreen image.
>>
>>
>> We checked the following files:
>> (1)
>> apache error logs:
>> MSG: Got a sequence without letters. Could not guess alphabet, referer:
>> http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
>>
>> (2)
>> *ll /var/lib/gbrowse2/databases/*
>> drwxrwxrwx  2 root   root    4096 Jan 27 17:49 volvox
>>
>> *ll /var/lib/gbrowse2/databases/volvox*
>> -rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
>>
>> *wc directory.index *
>>    0     3 12288 directory.index
>>
>> (3)
>> We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
>> into /var/lib/gbrowse2/databases/volvox/
>>
>> (4)
>> we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
>> *more /var/lib/gbrowse2/databases/volvox/volvox.fa*
>>> ctgA
>> cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat
>> tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
>> ......
>>
>> (5)
>> *volvox.conf* in /etc/gbrowse2
>>
>> [GENERAL]
>> db_adaptor    = Bio::DB::SeqFeature::Store
>> db_args       = -adaptor memory
>>                -dir '/var/lib/gbrowse2/databases/volvox'
>> ......
>> [DNA]
>> glyph          = dna
>> global feature = 1
>> height         = 40
>> do_gc          = 1
>> gc_window      = auto
>> fgcolor        = red
>> axis_color     = blue
>> strand         = both
>> key            = DNA/GC Content
>> ......
>>
>> Thanks.
>> eman
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> WatchGuard Dimension instantly turns raw network data into actionable
>> security intelligence. It gives you real-time visual feedback on key
>> security issues and trends.  Skip the complicated setup - simply import
>> a virtual appliance and go from zero to informed in seconds.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>
> ------------------------------------------------------------------------------
> WatchGuard Dimension instantly turns raw network data into actionable
> security intelligence. It gives you real-time visual feedback on key
> security issues and trends.  Skip the complicated setup - simply import
> a virtual appliance and go from zero to informed in seconds.
> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> </quote>
> Quoted from:
> http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
>
>
> _____________________________________
> Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
>


------------------------------------------------------------------------------
Start Your Social Network Today - Download eXo Platform
Build your Enterprise Intranet with eXo Platform Software
Java Based Open Source Intranet - Social, Extensible, Cloud Ready
Get Started Now And Turn Your Intranet Into A Collaboration Platform
http://p.sf.net/sfu/ExoPlatform
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Screenshot-1.png (191K) Download Attachment
Reply | Threaded
Open this post in threaded view
|

Re: No Gc content and six frame translation in GBrowse

rayapadi swetha
Dear Sir,

I am waiting for your reply. And also, I want to know, Do we need to get the license or permission from GMOD to use the GBrowse in our database which is underprogress for publication.

-Swetha


On Sat, Apr 26, 2014 at 9:41 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

Thank you for your reply.

The Directory.index was not created in the database directory and I gave permission to the database directory. Even the restriction sites are not displaying after updating .conf file with "plugins     = TrackDumper Aligner RestrictionAnnotator". I attached the screenshot of the page for your reference.


The error log shows

[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] MSG: Could not open /var/lib/gbrowse2/databases/streptococcus: No such file or directory, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Error::throw, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Root::Root::throw /usr/local/share/perl5/Bio/Root/Root.pm:486, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_calc_termination_length /usr/local/share/perl5/Bio/DB/IndexedBase.pm:749, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_index_files /usr/local/share/perl5/Bio/DB/IndexedBase.pm:633, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::index_dir /usr/local/share/perl5/Bio/DB/IndexedBase.pm:446, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::new /usr/local/share/perl5/Bio/DB/IndexedBase.pm:361, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::commit /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:172, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::GFF3Loader::finish_load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:352, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load_fh /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:354, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::post_init /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:164, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::new /usr/local/share/perl5/Bio/DB/SeqFeature/Store.pm:395, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataBase::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm:44, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:997, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::default_dbid /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:1033, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::RegionSearch::init_databases /usr/local/lib64/perl5/Bio/Graphics/Browser2/RegionSearch.pm:125, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::get_search_object /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1234, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::PluginSet::configure /usr/local/lib64/perl5/Bio/Graphics/Browser2/PluginSet.pm:88, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::init_plugins /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1279, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Action::ACTION_retrieve_multiple /usr/local/lib64/perl5/Bio/Graphics/Browser2/Action.pm:282, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:430, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run_asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:359, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:277, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: /var/apache/cgi-bin/gb2/gbrowse:54, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] -----------------------------------------------------------, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/

Can you please fix this error and help me with this. Awaiting for your reply.

-Swetha Rayapadi




On Fri, Apr 25, 2014 at 8:31 PM, Scott Cain <[hidden email]> wrote:
Hi Swetha,

Please ask questions like this on the gbrowse mailing list.

Did the directory.index file get created?  Is there anything in the apache error log that might point to a problem?  My first guess is a directory permission problem: the web server is unable the write in that directory.

Scott

Sent from my iPad

> On Apr 25, 2014, at 8:21 AM, [hidden email] wrote:
>
> Hello Sir,
>
> I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
>
> -Swetha.
>
>
> <quote author='Scott Cain'>
> Hi Eman,
>
> The most likely problem is that you tried to view the DNA and GC content
> before you added the fasta file.  When that happens, GBrowse will create
> the directory.index file with nothing in it.  GBrowse doesn't know that you
> added a fasta file after that, so it continues to think there is nothing
> there.  The fix is to delete the directory.index file and try again.
>
> Scott
>
>
>
>> On Mon, Jan 27, 2014 at 7:36 AM, EmanLee <[hidden email]> wrote:
>>
>> I have followed all the steps (include the GC content and 6 frame
>> translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
>> x86_64).
>> But, there are no "*GC content and 6 frame translation*" data displayed
>> as the snapscreen image.
>>
>>
>> We checked the following files:
>> (1)
>> apache error logs:
>> MSG: Got a sequence without letters. Could not guess alphabet, referer:
>> http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
>>
>> (2)
>> *ll /var/lib/gbrowse2/databases/*
>> drwxrwxrwx  2 root   root    4096 Jan 27 17:49 volvox
>>
>> *ll /var/lib/gbrowse2/databases/volvox*
>> -rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
>>
>> *wc directory.index *
>>    0     3 12288 directory.index
>>
>> (3)
>> We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
>> into /var/lib/gbrowse2/databases/volvox/
>>
>> (4)
>> we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
>> *more /var/lib/gbrowse2/databases/volvox/volvox.fa*
>>> ctgA
>> cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat
>> tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
>> ......
>>
>> (5)
>> *volvox.conf* in /etc/gbrowse2
>>
>> [GENERAL]
>> db_adaptor    = Bio::DB::SeqFeature::Store
>> db_args       = -adaptor memory
>>                -dir '/var/lib/gbrowse2/databases/volvox'
>> ......
>> [DNA]
>> glyph          = dna
>> global feature = 1
>> height         = 40
>> do_gc          = 1
>> gc_window      = auto
>> fgcolor        = red
>> axis_color     = blue
>> strand         = both
>> key            = DNA/GC Content
>> ......
>>
>> Thanks.
>> eman
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> WatchGuard Dimension instantly turns raw network data into actionable
>> security intelligence. It gives you real-time visual feedback on key
>> security issues and trends.  Skip the complicated setup - simply import
>> a virtual appliance and go from zero to informed in seconds.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>
> ------------------------------------------------------------------------------
> WatchGuard Dimension instantly turns raw network data into actionable
> security intelligence. It gives you real-time visual feedback on key
> security issues and trends.  Skip the complicated setup - simply import
> a virtual appliance and go from zero to informed in seconds.
> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> </quote>
> Quoted from:
> http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
>
>
> _____________________________________
> Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
>



------------------------------------------------------------------------------
"Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE
Instantly run your Selenium tests across 300+ browser/OS combos.  Get
unparalleled scalability from the best Selenium testing platform available.
Simple to use. Nothing to install. Get started now for free."
http://p.sf.net/sfu/SauceLabs
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: No Gc content and six frame translation in GBrowse

Scott Cain
Hi Swetha,

Are you using the memory adaptor?  Generally that's not a good idea with a production database as it tends to be really slow, but perhaps it won't be bad with bacterial genomes since they're small.

I think there is a bug in the current release of BioPerl that's causing this problem.  I'd suggest installing BioPerl 1.6.901:

  tar zxvf BioPerl-1.6.901.tar.gz
  cd BioPerl-1.6.901
  perl Build.PL
  ./Build
  ./Build test
  sudo ./Build install --uninst 1

The "--uninst 1" will make sure it removes other BioPerl modules from the newer distribution.

For licensing: GBrowse is licensed under the Perl Artistic 2 license, which (a legalese aside) means you can do what you want with it.

Scott



On Tue, Apr 29, 2014 at 12:03 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

I am waiting for your reply. And also, I want to know, Do we need to get the license or permission from GMOD to use the GBrowse in our database which is underprogress for publication.

-Swetha


On Sat, Apr 26, 2014 at 9:41 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

Thank you for your reply.

The Directory.index was not created in the database directory and I gave permission to the database directory. Even the restriction sites are not displaying after updating .conf file with "plugins     = TrackDumper Aligner RestrictionAnnotator". I attached the screenshot of the page for your reference.


The error log shows

[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] MSG: Could not open /var/lib/gbrowse2/databases/streptococcus: No such file or directory, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Error::throw, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Root::Root::throw /usr/local/share/perl5/Bio/Root/Root.pm:486, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_calc_termination_length /usr/local/share/perl5/Bio/DB/IndexedBase.pm:749, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_index_files /usr/local/share/perl5/Bio/DB/IndexedBase.pm:633, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::index_dir /usr/local/share/perl5/Bio/DB/IndexedBase.pm:446, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::new /usr/local/share/perl5/Bio/DB/IndexedBase.pm:361, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::commit /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:172, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::GFF3Loader::finish_load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:352, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load_fh /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:354, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::post_init /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:164, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::new /usr/local/share/perl5/Bio/DB/SeqFeature/Store.pm:395, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataBase::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm:44, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:997, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::default_dbid /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:1033, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::RegionSearch::init_databases /usr/local/lib64/perl5/Bio/Graphics/Browser2/RegionSearch.pm:125, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::get_search_object /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1234, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::PluginSet::configure /usr/local/lib64/perl5/Bio/Graphics/Browser2/PluginSet.pm:88, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::init_plugins /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1279, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Action::ACTION_retrieve_multiple /usr/local/lib64/perl5/Bio/Graphics/Browser2/Action.pm:282, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:430, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run_asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:359, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:277, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: /var/apache/cgi-bin/gb2/gbrowse:54, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] -----------------------------------------------------------, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/

Can you please fix this error and help me with this. Awaiting for your reply.

-Swetha Rayapadi




On Fri, Apr 25, 2014 at 8:31 PM, Scott Cain <[hidden email]> wrote:
Hi Swetha,

Please ask questions like this on the gbrowse mailing list.

Did the directory.index file get created?  Is there anything in the apache error log that might point to a problem?  My first guess is a directory permission problem: the web server is unable the write in that directory.

Scott

Sent from my iPad

> On Apr 25, 2014, at 8:21 AM, [hidden email] wrote:
>
> Hello Sir,
>
> I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
>
> -Swetha.
>
>
> <quote author='Scott Cain'>
> Hi Eman,
>
> The most likely problem is that you tried to view the DNA and GC content
> before you added the fasta file.  When that happens, GBrowse will create
> the directory.index file with nothing in it.  GBrowse doesn't know that you
> added a fasta file after that, so it continues to think there is nothing
> there.  The fix is to delete the directory.index file and try again.
>
> Scott
>
>
>
>> On Mon, Jan 27, 2014 at 7:36 AM, EmanLee <[hidden email]> wrote:
>>
>> I have followed all the steps (include the GC content and 6 frame
>> translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
>> x86_64).
>> But, there are no "*GC content and 6 frame translation*" data displayed
>> as the snapscreen image.
>>
>>
>> We checked the following files:
>> (1)
>> apache error logs:
>> MSG: Got a sequence without letters. Could not guess alphabet, referer:
>> http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
>>
>> (2)
>> *ll /var/lib/gbrowse2/databases/*
>> drwxrwxrwx  2 root   root    4096 Jan 27 17:49 volvox
>>
>> *ll /var/lib/gbrowse2/databases/volvox*
>> -rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
>>
>> *wc directory.index *
>>    0     3 12288 directory.index
>>
>> (3)
>> We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
>> into /var/lib/gbrowse2/databases/volvox/
>>
>> (4)
>> we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
>> *more /var/lib/gbrowse2/databases/volvox/volvox.fa*
>>> ctgA
>> cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat
>> tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
>> ......
>>
>> (5)
>> *volvox.conf* in /etc/gbrowse2
>>
>> [GENERAL]
>> db_adaptor    = Bio::DB::SeqFeature::Store
>> db_args       = -adaptor memory
>>                -dir '/var/lib/gbrowse2/databases/volvox'
>> ......
>> [DNA]
>> glyph          = dna
>> global feature = 1
>> height         = 40
>> do_gc          = 1
>> gc_window      = auto
>> fgcolor        = red
>> axis_color     = blue
>> strand         = both
>> key            = DNA/GC Content
>> ......
>>
>> Thanks.
>> eman
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> WatchGuard Dimension instantly turns raw network data into actionable
>> security intelligence. It gives you real-time visual feedback on key
>> security issues and trends.  Skip the complicated setup - simply import
>> a virtual appliance and go from zero to informed in seconds.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     <a href="tel:216-392-3087" value="+12163923087" target="_blank">216-392-3087
> Ontario Institute for Cancer Research
>
> ------------------------------------------------------------------------------
> WatchGuard Dimension instantly turns raw network data into actionable
> security intelligence. It gives you real-time visual feedback on key
> security issues and trends.  Skip the complicated setup - simply import
> a virtual appliance and go from zero to informed in seconds.
> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> </quote>
> Quoted from:
> http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
>
>
> _____________________________________
> Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
>





--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
"Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE
Instantly run your Selenium tests across 300+ browser/OS combos.  Get
unparalleled scalability from the best Selenium testing platform available.
Simple to use. Nothing to install. Get started now for free."
http://p.sf.net/sfu/SauceLabs
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: No Gc content and six frame translation in GBrowse

Scott Cain
Hi Swetha,

When this happens it is almost always because the name of the sequence in the fasta file doesn't agree with the name of the sequence in the GFF file.  The name in the first column of the GFF file (the reference sequence) has to be exactly the same (case matters) as the name after the ">" in the fasta file.  If they aren't the same, GBrowse can't tell that they go together.

Scott



On Mon, May 5, 2014 at 7:17 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

I have installed BioPerl 1.3.901 and there is no bugs in error log. The directory.index file is created. But, still GC content and 6-frame translation is not working.

The example given in the tutorial is working good but not for our organism. Actually, I placed the gff3 and faa file of that organism in a folder which is downloaded from NCBI FTP in database folder. Do I need to have any other file to be placed in the database folder to make it work?

Yours sincerely,

Swetha R G.


On Wed, Apr 30, 2014 at 9:08 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

Thank you for your reply.

Let me try to install BioPerl 1.6.901.

-Swetha R G.


On Tue, Apr 29, 2014 at 9:42 PM, Scott Cain <[hidden email]> wrote:
Hi Swetha,

Are you using the memory adaptor?  Generally that's not a good idea with a production database as it tends to be really slow, but perhaps it won't be bad with bacterial genomes since they're small.

I think there is a bug in the current release of BioPerl that's causing this problem.  I'd suggest installing BioPerl 1.6.901:

  tar zxvf BioPerl-1.6.901.tar.gz
  cd BioPerl-1.6.901
  perl Build.PL
  ./Build
  ./Build test
  sudo ./Build install --uninst 1

The "--uninst 1" will make sure it removes other BioPerl modules from the newer distribution.

For licensing: GBrowse is licensed under the Perl Artistic 2 license, which (a legalese aside) means you can do what you want with it.

Scott



On Tue, Apr 29, 2014 at 12:03 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

I am waiting for your reply. And also, I want to know, Do we need to get the license or permission from GMOD to use the GBrowse in our database which is underprogress for publication.

-Swetha


On Sat, Apr 26, 2014 at 9:41 AM, rayapadi swetha <[hidden email]> wrote:
Dear Sir,

Thank you for your reply.

The Directory.index was not created in the database directory and I gave permission to the database directory. Even the restriction sites are not displaying after updating .conf file with "plugins     = TrackDumper Aligner RestrictionAnnotator". I attached the screenshot of the page for your reference.


The error log shows

[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] MSG: Could not open /var/lib/gbrowse2/databases/streptococcus: No such file or directory, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Error::throw, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Root::Root::throw /usr/local/share/perl5/Bio/Root/Root.pm:486, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_calc_termination_length /usr/local/share/perl5/Bio/DB/IndexedBase.pm:749, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::_index_files /usr/local/share/perl5/Bio/DB/IndexedBase.pm:633, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::index_dir /usr/local/share/perl5/Bio/DB/IndexedBase.pm:446, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::IndexedBase::new /usr/local/share/perl5/Bio/DB/IndexedBase.pm:361, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::commit /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:172, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::GFF3Loader::finish_load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:352, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load_fh /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:354, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::Loader::load /usr/local/share/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::memory::post_init /usr/local/share/perl5/Bio/DB/SeqFeature/Store/memory.pm:164, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::DB::SeqFeature::Store::new /usr/local/share/perl5/Bio/DB/SeqFeature/Store.pm:395, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataBase::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm:44, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::open_database /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:997, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::DataSource::default_dbid /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm:1033, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::RegionSearch::init_databases /usr/local/lib64/perl5/Bio/Graphics/Browser2/RegionSearch.pm:125, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::get_search_object /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1234, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::PluginSet::configure /usr/local/lib64/perl5/Bio/Graphics/Browser2/PluginSet.pm:88, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::init_plugins /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:1279, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Action::ACTION_retrieve_multiple /usr/local/lib64/perl5/Bio/Graphics/Browser2/Action.pm:282, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:430, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run_asynchronous_event /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:359, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: Bio::Graphics::Browser2::Render::run /usr/local/lib64/perl5/Bio/Graphics/Browser2/Render.pm:277, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] STACK: /var/apache/cgi-bin/gb2/gbrowse:54, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/
[Sat Apr 26 09:14:45 2014] [error] [client 10.132.1.14] -----------------------------------------------------------, referer: http://10.132.1.14/cgi-bin/gb2/gbrowse/Streptococcus%20penumoniae%20670-6B/

Can you please fix this error and help me with this. Awaiting for your reply.

-Swetha Rayapadi




On Fri, Apr 25, 2014 at 8:31 PM, Scott Cain <[hidden email]> wrote:
Hi Swetha,

Please ask questions like this on the gbrowse mailing list.

Did the directory.index file get created?  Is there anything in the apache error log that might point to a problem?  My first guess is a directory permission problem: the web server is unable the write in that directory.

Scott

Sent from my iPad

> On Apr 25, 2014, at 8:21 AM, [hidden email] wrote:
>
> Hello Sir,
>
> I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
>
> -Swetha.
>
>
> <quote author='Scott Cain'>
> Hi Eman,
>
> The most likely problem is that you tried to view the DNA and GC content
> before you added the fasta file.  When that happens, GBrowse will create
> the directory.index file with nothing in it.  GBrowse doesn't know that you
> added a fasta file after that, so it continues to think there is nothing
> there.  The fix is to delete the directory.index file and try again.
>
> Scott
>
>
>
>> On Mon, Jan 27, 2014 at 7:36 AM, EmanLee <[hidden email]> wrote:
>>
>> I have followed all the steps (include the GC content and 6 frame
>> translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
>> x86_64).
>> But, there are no "*GC content and 6 frame translation*" data displayed
>> as the snapscreen image.
>>
>>
>> We checked the following files:
>> (1)
>> apache error logs:
>> MSG: Got a sequence without letters. Could not guess alphabet, referer:
>> http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
>>
>> (2)
>> *ll /var/lib/gbrowse2/databases/*
>> drwxrwxrwx  2 root   root    4096 Jan 27 17:49 volvox
>>
>> *ll /var/lib/gbrowse2/databases/volvox*
>> -rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
>>
>> *wc directory.index *
>>    0     3 12288 directory.index
>>
>> (3)
>> We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
>> into /var/lib/gbrowse2/databases/volvox/
>>
>> (4)
>> we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
>> *more /var/lib/gbrowse2/databases/volvox/volvox.fa*
>>> ctgA
>> cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat
>> tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
>> ......
>>
>> (5)
>> *volvox.conf* in /etc/gbrowse2
>>
>> [GENERAL]
>> db_adaptor    = Bio::DB::SeqFeature::Store
>> db_args       = -adaptor memory
>>                -dir '/var/lib/gbrowse2/databases/volvox'
>> ......
>> [DNA]
>> glyph          = dna
>> global feature = 1
>> height         = 40
>> do_gc          = 1
>> gc_window      = auto
>> fgcolor        = red
>> axis_color     = blue
>> strand         = both
>> key            = DNA/GC Content
>> ......
>>
>> Thanks.
>> eman
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> WatchGuard Dimension instantly turns raw network data into actionable
>> security intelligence. It gives you real-time visual feedback on key
>> security issues and trends.  Skip the complicated setup - simply import
>> a virtual appliance and go from zero to informed in seconds.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     <a href="tel:216-392-3087" value="+12163923087" target="_blank">216-392-3087
> Ontario Institute for Cancer Research
>
> ------------------------------------------------------------------------------
> WatchGuard Dimension instantly turns raw network data into actionable
> security intelligence. It gives you real-time visual feedback on key
> security issues and trends.  Skip the complicated setup - simply import
> a virtual appliance and go from zero to informed in seconds.
> http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> </quote>
> Quoted from:
> http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
>
>
> _____________________________________
> Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
>





--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     <a href="tel:216-392-3087" value="+12163923087" target="_blank">216-392-3087
Ontario Institute for Cancer Research





--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Is your legacy SCM system holding you back? Join Perforce May 7 to find out:
&#149; 3 signs your SCM is hindering your productivity
&#149; Requirements for releasing software faster
&#149; Expert tips and advice for migrating your SCM now
http://p.sf.net/sfu/perforce
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse