Re: webgbrowse questions

classic Classic list List threaded Threaded
2 messages Options
Reply | Threaded
Open this post in threaded view
|

Re: webgbrowse questions

Ram Podicheti-2

You can include the FASTA sequence inside a GFF3 file. At the end of the .gff3 file, after the annotation data, you can include the contents from your .fa file. The annotation and the sequence information must be separated by the line

 

##fasta

 

Here is an example.

 

ctgA  est   EST_match   7500  8000  .     -     .     ID=Match4;Name=agt221.3;Target=agt221.3 1 501

ctgA  est   EST_match   1150  1500  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 1 351

ctgA  est   EST_match   5000  5500  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 352 852

ctgA  est   EST_match   7000  7200  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 853 1153

ctgA  est   EST_match   8000  9000  .     -     .     ID=Match6;Name=agt767.3;Target=agt767.3 1 1001

##fasta

>ctgA

cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat

tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg

aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc

ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca

acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag

atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac

gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc

 

 

Ram

 

 

From: LES升(農民) [mailto:[hidden email]]
Sent: Saturday, May 05, 2012 9:27 PM
To: Podicheti, Ram
Subject: webgbrowse questions

 

Hi,
  I have a doubt, in the Gbrowse system, when we use the Mysql to store the data, we must use the .gff3 and .fa files,but in the Webgbrowse system, just use the .gff3 files . Can you tell me how to do this? Thanks-Lin


------------------------------------------------------------------------------
Live Security Virtual Conference
Exclusive live event will cover all the ways today's security and
threat landscape has changed and how IT managers can respond. Discussions
will include endpoint security, mobile security and the latest in malware
threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
_______________________________________________
Gmod-webgbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-webgbrowse
Reply | Threaded
Open this post in threaded view
|

Re: webgbrowse questions

LES升(農民)
Thanks-Lin
 
 
------------------ Original ------------------
From: "mnrusimh";
Date: 2012年5月6日(星期天) 中午11:01
To: "LES升(農民)";
Subject: RE: webgbrowse questions
 

You can include the FASTA sequence inside a GFF3 file. At the end of the .gff3 file, after the annotation data, you can include the contents from your .fa file. The annotation and the sequence information must be separated by the line

 

##fasta

 

Here is an example.

 

ctgA  est   EST_match   7500  8000  .     -     .     ID=Match4;Name=agt221.3;Target=agt221.3 1 501

ctgA  est   EST_match   1150  1500  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 1 351

ctgA  est   EST_match   5000  5500  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 352 852

ctgA  est   EST_match   7000  7200  .     +     .     ID=Match5;Name=agt767.5;Target=agt767.5 853 1153

ctgA  est   EST_match   8000  9000  .     -     .     ID=Match6;Name=agt767.3;Target=agt767.3 1 1001

##fasta

>ctgA

cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgat

tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg

aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc

ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca

acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag

atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac

gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc

 

 

Ram

 

 

From: LES升(農民) [mailto:[hidden email]]
Sent: Saturday, May 05, 2012 9:27 PM
To: Podicheti, Ram
Subject: webgbrowse questions

 

Hi,
  I have a doubt, in the Gbrowse system, when we use the Mysql to store the data, we must use the .gff3 and .fa files,but in the Webgbrowse system, just use the .gff3 files . Can you tell me how to do this? Thanks-Lin


------------------------------------------------------------------------------
Live Security Virtual Conference
Exclusive live event will cover all the ways today's security and
threat landscape has changed and how IT managers can respond. Discussions
will include endpoint security, mobile security and the latest in malware
threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
_______________________________________________
Gmod-webgbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-webgbrowse