Retrieving sequences

classic Classic list List threaded Threaded
2 messages Options
Reply | Threaded
Open this post in threaded view
|

Retrieving sequences

J.M.P. Alves
Hi,

I have an instance of GBrowse 2 with contigs and ESTs (result of BLASTN
alignment) loaded. The details page show the alignments nicely in the
matches part.

But there is a possible problem -- and a question.

Here's the beginning of the alignment, with the contig sequence
(reference) on top and the EST (query) on the bottom:
TRA_g1_contig06086 18607
GTTCTCACGGGCATTCTGTAG-AAACAAACTCAGTACTCGGTAATACCCTTCCCACGGCA 18549
|||||||||||||||||| |  |||||||||||| |||||||||||||||||||||||||
gi|218981313|gb|FG238296.1|FG238296    29
GTTCTCACGGGCATTCTGCATCAAACAAACTCAGCACTCGGTAATACCCTTCCCACGGCA 88

I double checked and this is correct, that is indeed the EST's sequence.

And here is the beginning of the sequence given at the bottom of the
details page:
 >gi|218981313|gb|FG238296.1|FG238296 class=Sequence
position=TRA_g1_contig06086:18289..18607 (- strand)
GTTCTCACGG GCATTCTGTA GAAACAAACT CAGTACTCGG TAATACCCTT CCCACGGCAG
CGCTGCCGCC AAGGCCGCCA

As you might be able to see, the sequence at the bottom of the page, in
spite of having the query's identifier, is actually the sequence
corresponding to the reference.

Another question: how do I access the query sequence directly, e.g. to
download the whole EST and not just see the aligned part (by using a
link in a balloon, probably, but if it displays in the details page
that's fine too)?

Thanks in advance
J

--
-------------------------------
João Marcelo Pereira Alves (J)
Post-doctoral fellow
MCV / VCU - Richmond, VA
http://bioinfo.lpb.mic.vcu.edu
f. 1-804-828-3897


------------------------------------------------------------------------------
This SF.net email is sponsored by

Make an app they can't live without
Enter the BlackBerry Developer Challenge
http://p.sf.net/sfu/RIM-dev2dev 
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: Retrieving sequences

Scott Cain
Hi J,

The reason the sequence at the bottom of the page is using the name of
the EST is that is what you used as an identifier for it in the GFF;
it's the same as if you would have used "gene xyz" as the identifier.
In your case however, it does lead to a potential confusion on the
users part.  The sequence at the bottom of the page is always going to
be from the reference sequence.  As far as I know, there isn't a way
to directly access the sequence of the EST, short of adding the
sequence as an attribute of the match feature, and then you could pull
it out via a callback.

Scott


On Wed, Aug 18, 2010 at 4:36 PM, J.M.P. Alves <[hidden email]> wrote:

> Hi,
>
> I have an instance of GBrowse 2 with contigs and ESTs (result of BLASTN
> alignment) loaded. The details page show the alignments nicely in the
> matches part.
>
> But there is a possible problem -- and a question.
>
> Here's the beginning of the alignment, with the contig sequence
> (reference) on top and the EST (query) on the bottom:
> TRA_g1_contig06086 18607
> GTTCTCACGGGCATTCTGTAG-AAACAAACTCAGTACTCGGTAATACCCTTCCCACGGCA 18549
> |||||||||||||||||| |  |||||||||||| |||||||||||||||||||||||||
> gi|218981313|gb|FG238296.1|FG238296    29
> GTTCTCACGGGCATTCTGCATCAAACAAACTCAGCACTCGGTAATACCCTTCCCACGGCA 88
>
> I double checked and this is correct, that is indeed the EST's sequence.
>
> And here is the beginning of the sequence given at the bottom of the
> details page:
>  >gi|218981313|gb|FG238296.1|FG238296 class=Sequence
> position=TRA_g1_contig06086:18289..18607 (- strand)
> GTTCTCACGG GCATTCTGTA GAAACAAACT CAGTACTCGG TAATACCCTT CCCACGGCAG
> CGCTGCCGCC AAGGCCGCCA
>
> As you might be able to see, the sequence at the bottom of the page, in
> spite of having the query's identifier, is actually the sequence
> corresponding to the reference.
>
> Another question: how do I access the query sequence directly, e.g. to
> download the whole EST and not just see the aligned part (by using a
> link in a balloon, probably, but if it displays in the details page
> that's fine too)?
>
> Thanks in advance
> J
>
> --
> -------------------------------
> João Marcelo Pereira Alves (J)
> Post-doctoral fellow
> MCV / VCU - Richmond, VA
> http://bioinfo.lpb.mic.vcu.edu
> f. 1-804-828-3897
>
>
> ------------------------------------------------------------------------------
> This SF.net email is sponsored by
>
> Make an app they can't live without
> Enter the BlackBerry Developer Challenge
> http://p.sf.net/sfu/RIM-dev2dev
> _______________________________________________
> Gmod-gbrowse mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
This SF.net email is sponsored by

Make an app they can't live without
Enter the BlackBerry Developer Challenge
http://p.sf.net/sfu/RIM-dev2dev 
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse