ace2gff3-1.0.5.pl

classic Classic list List threaded Threaded
3 messages Options
Reply | Threaded
Open this post in threaded view
|

ace2gff3-1.0.5.pl

Tony Power
Hi Stephen,

I don't know if you remember me. We spoke last year.
I still don't have the database implemented.  Now I have all the data
needed (fasta + ace files).
I am using your script to create the gff3 file. Although something is
being generated, I keep seeing errors, like this one:
----------------------------------
Use of uninitialized value $est_seq_whole in substitution (s///) at
ace2gff3-1.0.5.pl line 398, <GEN45> line 2986.
Use of uninitialized value $est_seq_whole in index at
ace2gff3-1.0.5.pl line 400, <GEN45> line 2986.
Use of uninitialized value $_[0] in lc at ace2gff3-1.0.5.pl line 513,
<GEN45> line 2986.
Use of uninitialized value $est_seq_whole_rc in index at
ace2gff3-1.0.5.pl line 403, <GEN45> line 2986.
####################################
FAILED FS4VA1R01BXDJD.1-124
est_seq_ungapped
GTGTTCTTAAGAATTTACACTCTGTACATTGTACATGATGGTACATAAAATACGTTATTGTACATGAAATAACAACTAAGCTAATTGTTATAGTGTAATAAATATAATTAACAATGGTTGAATGG
==
Use of uninitialized value $est_seq_whole in concatenation (.) or
string at ace2gff3-1.0.5.pl line 411, <GEN45> line 2986.
est_seq_whole
==
Use of uninitialized value $est_seq_whole_rc in concatenation (.) or
string at ace2gff3-1.0.5.pl line 413, <GEN45> line 2986.
est_seq_whole_rc
==
done
----------------------------------

And, keeps repeating ....

I am afraid that the GFF3 file won't be correct. Should I ignore this?
The ace was produced using mira. I am issuing the command:
perl ace2gff3-1.0.5.pl -f assembly_rud_dec.fasta -a ruddec.ace -o
rud.gff -n "Rud" -d "2011-01-01" -w "mira" -v "3.2" -c "454 optimized"
-u "1.0"


Thank you for your help.

------------------------------------------------------------------------------
Better than sec? Nothing is better than sec when it comes to
monitoring Big Data applications. Try Boundary one-second
resolution app monitoring today. Free.
http://p.sf.net/sfu/Boundary-dev2dev
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: ace2gff3-1.0.5.pl

Stephen Ficklin-2
Hi Tony,

Yes I remember. It's nice to hear from you.  I hope all is going well.

You're getting the error message about the $est_seq_whole variable being
uninitialized because there is no sequence data for the EST in that
variable.  That variable gets set from the sequence in the FASTA file.  
The script expects that the name of the sequence in the FASTA file be
the first word in the definition line of each sequence.  The first word
must then match the EST names in the alignment file.

It has been a while since we wrote that script, but one thing I remember
is that it worked well for CAP3 and SeqManPro but did not work well for
other alignment tools.  It seems the ACE format is not very strict and
different aligners vary the format somewhat.  So, in the end, you'll
want to check the GFF file to make sure it matches your alignment.

Stephen

On 4/18/2012 2:36 PM, Tony Power wrote:

> Hi Stephen,
>
> I don't know if you remember me. We spoke last year.
> I still don't have the database implemented.  Now I have all the data
> needed (fasta + ace files).
> I am using your script to create the gff3 file. Although something is
> being generated, I keep seeing errors, like this one:
> ----------------------------------
> Use of uninitialized value $est_seq_whole in substitution (s///) at
> ace2gff3-1.0.5.pl line 398,<GEN45>  line 2986.
> Use of uninitialized value $est_seq_whole in index at
> ace2gff3-1.0.5.pl line 400,<GEN45>  line 2986.
> Use of uninitialized value $_[0] in lc at ace2gff3-1.0.5.pl line 513,
> <GEN45>  line 2986.
> Use of uninitialized value $est_seq_whole_rc in index at
> ace2gff3-1.0.5.pl line 403,<GEN45>  line 2986.
> ####################################
> FAILED FS4VA1R01BXDJD.1-124
> est_seq_ungapped
> GTGTTCTTAAGAATTTACACTCTGTACATTGTACATGATGGTACATAAAATACGTTATTGTACATGAAATAACAACTAAGCTAATTGTTATAGTGTAATAAATATAATTAACAATGGTTGAATGG
> ==
> Use of uninitialized value $est_seq_whole in concatenation (.) or
> string at ace2gff3-1.0.5.pl line 411,<GEN45>  line 2986.
> est_seq_whole
> ==
> Use of uninitialized value $est_seq_whole_rc in concatenation (.) or
> string at ace2gff3-1.0.5.pl line 413,<GEN45>  line 2986.
> est_seq_whole_rc
> ==
> done
> ----------------------------------
>
> And, keeps repeating ....
>
> I am afraid that the GFF3 file won't be correct. Should I ignore this?
> The ace was produced using mira. I am issuing the command:
> perl ace2gff3-1.0.5.pl -f assembly_rud_dec.fasta -a ruddec.ace -o
> rud.gff -n "Rud" -d "2011-01-01" -w "mira" -v "3.2" -c "454 optimized"
> -u "1.0"
>
>
> Thank you for your help.


------------------------------------------------------------------------------
For Developers, A Lot Can Happen In A Second.
Boundary is the first to Know...and Tell You.
Monitor Your Applications in Ultra-Fine Resolution. Try it FREE!
http://p.sf.net/sfu/Boundary-d2dvs2
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: ace2gff3-1.0.5.pl

Tony Power
Thanks Stephen,
I'll try to figure it out, and bother you again if needed :P

On Thu, Apr 19, 2012 at 6:38 PM, Stephen Ficklin <[hidden email]> wrote:

> Hi Tony,
>
> Yes I remember. It's nice to hear from you.  I hope all is going well.
>
> You're getting the error message about the $est_seq_whole variable being
> uninitialized because there is no sequence data for the EST in that
> variable.  That variable gets set from the sequence in the FASTA file.  The
> script expects that the name of the sequence in the FASTA file be the first
> word in the definition line of each sequence.  The first word must then
> match the EST names in the alignment file.
>
> It has been a while since we wrote that script, but one thing I remember is
> that it worked well for CAP3 and SeqManPro but did not work well for other
> alignment tools.  It seems the ACE format is not very strict and different
> aligners vary the format somewhat.  So, in the end, you'll want to check the
> GFF file to make sure it matches your alignment.
>
> Stephen
>
>
> On 4/18/2012 2:36 PM, Tony Power wrote:
>>
>> Hi Stephen,
>>
>> I don't know if you remember me. We spoke last year.
>> I still don't have the database implemented.  Now I have all the data
>> needed (fasta + ace files).
>> I am using your script to create the gff3 file. Although something is
>> being generated, I keep seeing errors, like this one:
>> ----------------------------------
>> Use of uninitialized value $est_seq_whole in substitution (s///) at
>> ace2gff3-1.0.5.pl line 398,<GEN45>  line 2986.
>> Use of uninitialized value $est_seq_whole in index at
>> ace2gff3-1.0.5.pl line 400,<GEN45>  line 2986.
>> Use of uninitialized value $_[0] in lc at ace2gff3-1.0.5.pl line 513,
>> <GEN45>  line 2986.
>> Use of uninitialized value $est_seq_whole_rc in index at
>> ace2gff3-1.0.5.pl line 403,<GEN45>  line 2986.
>> ####################################
>> FAILED FS4VA1R01BXDJD.1-124
>> est_seq_ungapped
>>
>> GTGTTCTTAAGAATTTACACTCTGTACATTGTACATGATGGTACATAAAATACGTTATTGTACATGAAATAACAACTAAGCTAATTGTTATAGTGTAATAAATATAATTAACAATGGTTGAATGG
>> ==
>> Use of uninitialized value $est_seq_whole in concatenation (.) or
>> string at ace2gff3-1.0.5.pl line 411,<GEN45>  line 2986.
>> est_seq_whole
>> ==
>> Use of uninitialized value $est_seq_whole_rc in concatenation (.) or
>> string at ace2gff3-1.0.5.pl line 413,<GEN45>  line 2986.
>> est_seq_whole_rc
>> ==
>> done
>> ----------------------------------
>>
>> And, keeps repeating ....
>>
>> I am afraid that the GFF3 file won't be correct. Should I ignore this?
>> The ace was produced using mira. I am issuing the command:
>> perl ace2gff3-1.0.5.pl -f assembly_rud_dec.fasta -a ruddec.ace -o
>> rud.gff -n "Rud" -d "2011-01-01" -w "mira" -v "3.2" -c "454 optimized"
>> -u "1.0"
>>
>>
>> Thank you for your help.
>
>

------------------------------------------------------------------------------
For Developers, A Lot Can Happen In A Second.
Boundary is the first to Know...and Tell You.
Monitor Your Applications in Ultra-Fine Resolution. Try it FREE!
http://p.sf.net/sfu/Boundary-d2dvs2
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal