[apollo] BLASTN strand problem

classic Classic list List threaded Threaded
2 messages Options
Reply | Threaded
Open this post in threaded view
|

[apollo] BLASTN strand problem

Hao Wang
Hi, all

When loading BLAST result to Apollo, I found the subject sequence
always showed on the "+" strand, even when it was actually in
complement strand of query (I list an example sequences below).
However, BLASTX works well. Does Apollo allow such subject showing on
"-" strand? Can anyone tell me how to do this?

example sequences:
>query
ACAGGACAACATGAACAACAATGAGGAACTTCCTATTACGAGTAAGCTGT
TTGCCATTATCCATTTGTTCCCACCAAGTCAATGCGTTGTACATTCCCTG
GTCATCAGCAAAAGGTGTCCCTTTCTTCCAATGGAAAAAGTGGTATGTGA
TC

>subject
ATCACATACCACTTTTTCCATTGGAAGAAAGGGACACCTTTTGCTGATGA
CCAGGGAATGTACAACGCATTGACTTGGTGGGAACAAATGGATAATGGCA
AACAGCTTACTCGTAATAGGAAGTT


Best wishes
Hao
_______________________________________________
apollo mailing list
[hidden email]
http://mail.fruitfly.org/mailman/listinfo/apollo
Reply | Threaded
Open this post in threaded view
|

Re: [apollo] BLASTN strand problem

Ed Lee
Hi Hao,

Are you loading the BLASTN results into Apollo?  I ran BLASTN
bl2seq (NCBI) for the two sequences (after having loaded the query
sequence) and the hit shows up on the minus strand as expected.
Are you loading NCBI BLAST or WU-BLAST results?  If you could
provide a detailed description of each step you take and
the data files, we can take a look to see if we can replicate
the issue.

Cheers,
Ed

On Wed, 26 May 2010, Hao Wang wrote:

> Hi, all
>
> When loading BLAST result to Apollo, I found the subject sequence
> always showed on the "+" strand, even when it was actually in
> complement strand of query (I list an example sequences below).
> However, BLASTX works well. Does Apollo allow such subject showing on
> "-" strand? Can anyone tell me how to do this?
>
> example sequences:
>> query
> ACAGGACAACATGAACAACAATGAGGAACTTCCTATTACGAGTAAGCTGT
> TTGCCATTATCCATTTGTTCCCACCAAGTCAATGCGTTGTACATTCCCTG
> GTCATCAGCAAAAGGTGTCCCTTTCTTCCAATGGAAAAAGTGGTATGTGA
> TC
>
>> subject
> ATCACATACCACTTTTTCCATTGGAAGAAAGGGACACCTTTTGCTGATGA
> CCAGGGAATGTACAACGCATTGACTTGGTGGGAACAAATGGATAATGGCA
> AACAGCTTACTCGTAATAGGAAGTT
>
>
> Best wishes
> Hao
> _______________________________________________
> apollo mailing list
> [hidden email]
> http://mail.fruitfly.org/mailman/listinfo/apollo
>
>
_______________________________________________
apollo mailing list
[hidden email]
http://mail.fruitfly.org/mailman/listinfo/apollo