[biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

classic Classic list List threaded Threaded
11 messages Options
Reply | Threaded
Open this post in threaded view
|

[biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

Pedro Barros
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

Steffen Durinck-2
Hi Pedro,

Getting sequences is a little bit more difficult than a regular query.
Mainly because features such as "upstream_flank" are listed as attributes but you actually have to use them as a filter as you need to provide a value for them telling getBM how long the flank is that you need.  
Here is how you can get to your info:

#getting 2000bp upstream from the gene

p = getBM(attributes = c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank"), filters = c("ensembl_gene_id","upstream_flank"), values = list(c("AT1G64000", "AT3G46520"),2000),  mart = AtMart ,checkFilters = FALSE, bmHeader=TRUE)

#getting 2000bp upstream from the coding start site

p = getBM(attributes = c("ensembl_gene_id",  "ensembl_transcript_id", "coding_gene_flank"), filters = c("ensembl_gene_id","upstream_flank"), values = list(c("AT1G64000", "AT3G46520"),2000),  mart = AtMart ,checkFilters = FALSE, bmHeader=TRUE)


Cheers,

Steffen


On Wed, May 25, 2016 at 12:21 PM, Pedro Barros <[hidden email]> wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

Pedro Barros
Thank's a lot Steffen

cheers
Pedro


On Thursday, May 26, 2016 at 7:22:27 PM UTC+1, Steffen Durinck wrote:
Hi Pedro,

Getting sequences is a little bit more difficult than a regular query.
Mainly because features such as "upstream_flank" are listed as attributes but you actually have to use them as a filter as you need to provide a value for them telling getBM how long the flank is that you need.  
Here is how you can get to your info:

#getting 2000bp upstream from the gene

p = getBM(attributes = c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank"), filters = c("ensembl_gene_id","upstream_flank"), values = list(c("AT1G64000", "AT3G46520"),2000),  mart = AtMart ,checkFilters = FALSE, bmHeader=TRUE)

#getting 2000bp upstream from the coding start site

p = getBM(attributes = c("ensembl_gene_id",  "ensembl_transcript_id", "coding_gene_flank"), filters = c("ensembl_gene_id","upstream_flank"), values = list(c("AT1G64000", "AT3G46520"),2000),  mart = AtMart ,checkFilters = FALSE, bmHeader=TRUE)


Cheers,

Steffen


On Wed, May 25, 2016 at 12:21 PM, Pedro Barros <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="rIYBhRSHCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">pedro....@...> wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="<a href="http://plants.ensembl.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fplants.ensembl.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNHBRdn_zH3W-PNokIt4q5_ZLe7wPA&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fplants.ensembl.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNHBRdn_zH3W-PNokIt4q5_ZLe7wPA&#39;;return true;">plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="rIYBhRSHCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">biomart-user...@googlegroups.com.
Visit this group at <a href="https://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/group/biomart-users&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/group/biomart-users&#39;;return true;">https://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

[biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

ovidiu iancu
In reply to this post by Pedro Barros
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="<a href="http://plants.ensembl.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fplants.ensembl.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNHBRdn_zH3W-PNokIt4q5_ZLe7wPA&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fplants.ensembl.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNHBRdn_zH3W-PNokIt4q5_ZLe7wPA&#39;;return true;">plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

Arek Kasprzyk
Hi Ovidiu,

I am forwarding your email to Steffen, in case he maybe able to help you

a.

On 3 June 2016 at 19:34, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

Steffen Durinck-2
In reply to this post by ovidiu iancu
Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at [hidden email]


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

Thomas Maurel
Dear Steffen and Ovidiu,

I am afraid our registry file is wrong for this archive: http://mar2016.archive.ensembl.org/biomart/martservice?type=registry
The registry file is pointing to “archive.ensembl.org instead of “mar2016.archive.ensembl.org”.

I will let you know when this issue is fixed.
Apologies for any inconvenience caused.
Regards,
Thomas
On 8 Jul 2016, at 17:38, Steffen Durinck <[hidden email]> wrote:

Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:


> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at [hidden email]


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

Steffen Durinck-2
Thanks Thomas,

What about the upstream_flank filter that also seems unavailable in the current release?

Cheers,
Steffen

On Fri, Jul 8, 2016 at 9:44 AM, Thomas Maurel <[hidden email]> wrote:
Dear Steffen and Ovidiu,

I am afraid our registry file is wrong for this archive: http://mar2016.archive.ensembl.org/biomart/martservice?type=registry
The registry file is pointing to “archive.ensembl.org instead of “mar2016.archive.ensembl.org”.

I will let you know when this issue is fixed.
Apologies for any inconvenience caused.
Regards,
Thomas
On 8 Jul 2016, at 17:38, Steffen Durinck <[hidden email]> wrote:

Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:


> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at [hidden email]


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

Thomas Maurel
Dear Steffen and Ovidiu,

The registry issue has now been fixed. 
Steffen, the wrong registry was actually behind the upstream_flank filter not working. The query on the March 2016 archive is working for me now:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "mar2016.archive.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

USwest is working for me too:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

Cheers,
Thomas
On 8 Jul 2016, at 18:12, Steffen Durinck <[hidden email]> wrote:

Thanks Thomas,

What about the upstream_flank filter that also seems unavailable in the current release?

Cheers,
Steffen

On Fri, Jul 8, 2016 at 9:44 AM, Thomas Maurel <[hidden email]> wrote:
Dear Steffen and Ovidiu,

I am afraid our registry file is wrong for this archive: http://mar2016.archive.ensembl.org/biomart/martservice?type=registry
The registry file is pointing to “archive.ensembl.org instead of “mar2016.archive.ensembl.org”.

I will let you know when this issue is fixed.
Apologies for any inconvenience caused.
Regards,
Thomas
On 8 Jul 2016, at 17:38, Steffen Durinck <[hidden email]> wrote:

Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:


> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at [hidden email]


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] BioMart::Exception::Usage: Requests for flank sequence...

Steffen Durinck-2
Thanks Thomas!

And thanks Ovidiu for letting us know about this issue.

Best,
Steffen

On Fri, Jul 8, 2016 at 10:42 AM, Thomas Maurel <[hidden email]> wrote:
Dear Steffen and Ovidiu,

The registry issue has now been fixed. 
Steffen, the wrong registry was actually behind the upstream_flank filter not working. The query on the March 2016 archive is working for me now:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "mar2016.archive.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

USwest is working for me too:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

Cheers,
Thomas

On 8 Jul 2016, at 18:12, Steffen Durinck <[hidden email]> wrote:

Thanks Thomas,

What about the upstream_flank filter that also seems unavailable in the current release?

Cheers,
Steffen

On Fri, Jul 8, 2016 at 9:44 AM, Thomas Maurel <[hidden email]> wrote:
Dear Steffen and Ovidiu,

I am afraid our registry file is wrong for this archive: http://mar2016.archive.ensembl.org/biomart/martservice?type=registry
The registry file is pointing to “archive.ensembl.org instead of “mar2016.archive.ensembl.org”.

I will let you know when this issue is fixed.
Apologies for any inconvenience caused.
Regards,
Thomas
On 8 Jul 2016, at 17:38, Steffen Durinck <[hidden email]> wrote:

Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:


> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at [hidden email]


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <[hidden email]> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Re: BioMart::Exception::Usage: Requests for flank sequence...

ovidiu iancu
thank you all!

ovidiu dan iancu

On Friday, July 8, 2016, Steffen Durinck <[hidden email]> wrote:
Thanks Thomas!

And thanks Ovidiu for letting us know about this issue.

Best,
Steffen

On Fri, Jul 8, 2016 at 10:42 AM, Thomas Maurel <<a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;maurel@ebi.ac.uk&#39;);" target="_blank">maurel@...> wrote:
Dear Steffen and Ovidiu,

The registry issue has now been fixed. 
Steffen, the wrong registry was actually behind the upstream_flank filter not working. The query on the March 2016 archive is working for me now:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "mar2016.archive.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

USwest is working for me too:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")
> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

Cheers,
Thomas

On 8 Jul 2016, at 18:12, Steffen Durinck <<a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;sdurinck@gmail.com&#39;);" target="_blank">sdurinck@...> wrote:

Thanks Thomas,

What about the upstream_flank filter that also seems unavailable in the current release?

Cheers,
Steffen

On Fri, Jul 8, 2016 at 9:44 AM, Thomas Maurel <<a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;maurel@ebi.ac.uk&#39;);" target="_blank">maurel@...> wrote:
Dear Steffen and Ovidiu,

I am afraid our registry file is wrong for this archive: http://mar2016.archive.ensembl.org/biomart/martservice?type=registry
The registry file is pointing to “archive.ensembl.org instead of “mar2016.archive.ensembl.org”.

I will let you know when this issue is fixed.
Apologies for any inconvenience caused.
Regards,
Thomas
On 8 Jul 2016, at 17:38, Steffen Durinck <<a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;sdurinck@gmail.com&#39;);" target="_blank">sdurinck@...> wrote:

Hi Ovidiu, 

I'm not sure what is up with mar2016.archive.ensembl.org as I don't see any datasets in that archive:

> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",, host = "mar2016.archive.ensembl.org")

> listDatasets(currSpecieMart)

[1] dataset     description version    

<0 rows> (or 0-length row.names)


However when I do your query to the current ensembl biomart, I do get the same error as you:


> currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset='hsapiens_gene_ensembl', host = "uswest.ensembl.org")

> getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),filters = c("ensembl_gene_id","upstream_flank"), values = list("ENSG00000198888",20),  mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)

Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  : 

  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND


The error states the problem, it looks like the upstream_flank filter is no longer available as a filter in the ensembl biomart.

We can ask the Ensembl team to put it back by emailing their helpdesk at <a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;helpdesk@ensembl.org&#39;);" target="_blank">helpdesk@...


Cheers,

Steffen





On Fri, Jun 3, 2016 at 11:34 AM, ovidiu iancu <<a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;ovidiu.iancu@gmail.com&#39;);" target="_blank">ovidiu.iancu@...> wrote:
Hello

I found that the code provided by Steffen works in the Dec 2015 archived ensembl but not in the one before or after.

Dan

specie="hsapiens_gene_ensembl"
currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "dec2015.archive.ensembl.org")

 getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
  Flank-coding region (Gene) Ensembl Gene ID
1       CAATTCCTCTTCTTAACAAC ENSG00000198888

currSpecieMart = useMart(biomart = "ENSEMBL_MART_ENSEMBL",dataset=specie, host = "mar2016.archive.ensembl.org")
>  
>   getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),
+         filters = c("ensembl_gene_id","upstream_flank"),
+         values = list("ENSG00000198888",20), 
+         mart = currSpecieMart ,checkFilters = FALSE, bmHeader=TRUE)
Error in getBM(attributes = c("ensembl_gene_id", "coding_gene_flank"),  :
  Query ERROR: caught BioMart::Exception::Usage: Filter upstream_flank NOT FOUND
>

R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 14.04.3 LTS

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
 [1] stats4    grid      parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] seqinr_3.1-3          ade4_1.7-4            BiocGenerics_0.18.0   BiocInstaller_1.22.2  biomaRt_2.28.0        cluster_2.0.4         WGCNA_1.51          
 [8] fastcluster_1.1.20    dynamicTreeCut_1.63-1 VennDiagram_1.6.17    futile.logger_1.4.1   sgof_2.3              poibin_1.2            doMC_1.3.4          
[15] iterators_1.0.8       foreach_1.4.3       

loaded via a namespace (and not attached):
 [1] splines_3.3.0         lattice_0.20-33       colorspace_1.2-6      mgcv_1.8-12           XML_3.98-1.4          chron_2.3-47          survival_2.39-4     
 [8] foreign_0.8-66        DBI_0.4-1             RColorBrewer_1.1-2    lambda.r_1.1.7        matrixStats_0.50.2    plyr_1.8.3            munsell_0.4.3       
[15] gtable_0.2.0          codetools_0.2-14      latticeExtra_0.6-28   Biobase_2.32.0        permute_0.9-0         IRanges_2.6.0         doParallel_1.0.10   
[22] AnnotationDbi_1.34.3  preprocessCore_1.34.0 Rcpp_0.12.5           acepack_1.3-3.3       scales_0.4.0          vegan_2.3-5           S4Vectors_0.10.1    
[29] Hmisc_3.17-4          gridExtra_2.2.1       impute_1.46.0         ggplot2_2.1.0         bitops_1.0-6          tools_3.3.0           RCurl_1.95-4.8      
[36] RSQLite_1.0.0         Formula_1.2-1         futile.options_1.0.0  GO.db_3.3.0           MASS_7.3-45           Matrix_1.2-6          data.table_1.9.6    
[43] rpart_4.1-10          nnet_7.3-12           nlme_3.1-128          compiler_3.3.0      
>

On Wednesday, May 25, 2016 at 2:06:47 PM UTC-7, Pedro Barros wrote:
Hi,

I was trying to use the function getBM() to obtain the promoter regions of a set of A. thaliana genes (model plant), but I didn't manage to make it work. I'm using R.
First I tried to use getSequences() but apparently it only works with ENSEMBL_MART_ENSEMBL and not plants_mart. But I found somewhere on the web that getBM() could work, but the example was not what I wanted...
Basically I would like to use the attributes  "gene_flank" and "upstream_flank" but I always get this error

Error in getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000",  :
  Query ERROR: caught BioMart::Exception::Usage: Requests for flank sequence must be accompanied by an upstream_flank or downstream_flank request

this is a sample of the code:

AtMart= useMart("plants_mart", host="plants.ensembl.org", dataset= "athaliana_eg_gene")
attributes
= listAttributes(AtMart)
filter
= listFilters(AtMart)
attrs
<- c("ensembl_gene_id",  "ensembl_transcript_id", "gene_flank", "upstream_flank")
p
= getBM(attributes = attrs, filters = "ensembl_gene_id", values = c("AT1G64000", "AT3G46520"),  mart = AtMart )


I think that I need to say somewhere the size of the flanking region, but I don't know where... I tried to add it in the values field, but that is only related with filtering.
Does anyone has know how to do this?

Thanks in advance
Pedro


> sessionInfo()
R version 3.2.5 (2016-04-14)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu precise (12.04.5 LTS)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8      
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8  
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              
[10] LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C      

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] GenomicFeatures_1.22.13 AnnotationDbi_1.32.3    Biobase_2.30.0          GenomicRanges_1.22.4  
 [5] GenomeInfoDb_1.6.3      IRanges_2.4.8           S4Vectors_0.8.11        BiocGenerics_0.16.1    
 [9] biomaRt_2.26.1          BiocInstaller_1.20.3  

loaded via a namespace (and not attached):
 [1] XVector_0.10.0             GenomicAlignments_1.6.3    zlibbioc_1.16.0          
 [4] BiocParallel_1.4.3         tools_3.2.5                SummarizedExperiment_1.0.2
 [7] DBI_0.4-1                  lambda.r_1.1.7             futile.logger_1.4.1      
[10] rtracklayer_1.30.4         futile.options_1.0.0       bitops_1.0-6              
[13] RCurl_1.95-4.8             RSQLite_1.0.0              Biostrings_2.38.4        
[16] Rsamtools_1.22.0           XML_3.98-1.4              


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;biomart-users%2Bunsubscribe@googlegroups.com&#39;);" target="_blank">biomart-users+unsubscribe@....
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;biomart-users%2Bunsubscribe@googlegroups.com&#39;);" target="_blank">biomart-users+unsubscribe@....
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:_e(%7B%7D,&#39;cvml&#39;,&#39;biomart-users%2Bunsubscribe@googlegroups.com&#39;);" target="_blank">biomart-users+unsubscribe@....
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.


--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.