[biomart-users] Error in getBM

classic Classic list List threaded Threaded
4 messages Options
Reply | Threaded
Open this post in threaded view
|

[biomart-users] Error in getBM

Eleni Christodoulou
Dear Biomart community,

I am trying to retrieve some information for the dario-rerio genes (zebrafish). This is my code

library(biomaRt)
if(interactive()){
  mart = useMart("ENSEMBL_MART_ENSEMBL", dataset="drerio_gene_ensembl")
}
drerio_coding_and_flanking_all_genes = getBM(attributes=c("hgnc_symbol",'ensembl_transcript_id','coding','coding_transcript_flank'), mart=mart)

     
After some minutes, I get the following error
Error in getBM(attributes = c("hgnc_symbol", "ensembl_transcript_id",  :
  The query to the BioMart webservice returned an invalid result: the number of columns in the result table does not equal the number of attributes in the query. Please report this to the mailing list.


Could you please help me solve it? Is it maybe because I do a genomeWide query?

Thank you very much!
Eleni

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Error in getBM

Thomas Maurel
Dear Eleni,

I am afraid there are three issues here.
The first one is indeed that you are doing a genome wide query and that the BioMart software is not designed to handle these type of queries.
Could you please split your query in smaller chunks using a filter, for example you can run one query for each chromosome.
The second issue is that you can only query one sequence type at a time, so you should split this query into two, one for coding sequences and one for coding_transcript_flank, e.g:

> drerio_coding_chr1 = getBM(attributes=c(“hgnc_symbol",'ensembl_transcript_id','coding'),filters ='chromosome_name', values ="1", mart=mart)

Finally, the “coding_transcript_flank” sequence must be accompanied by an upstream_flank or downstream_flank request to work, e.g:

> drerio_flanking_all_genes_chr1_upstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",upstream=100, mart=mart)
> drerio_flanking_all_genes_chr1_downstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",downstream=100, mart=mart)

I hope this helps,
Best Regards,
Thomas
On 27 Oct 2016, at 05:07, Eleni Christodoulou <[hidden email]> wrote:

Dear Biomart community,

I am trying to retrieve some information for the dario-rerio genes (zebrafish). This is my code

library(biomaRt)
if(interactive()){
  mart = useMart("ENSEMBL_MART_ENSEMBL", dataset="drerio_gene_ensembl")
}
drerio_coding_and_flanking_all_genes = getBM(attributes=c("hgnc_symbol",'ensembl_transcript_id','coding','coding_transcript_flank'), mart=mart)

     
After some minutes, I get the following error
Error in getBM(attributes = c("hgnc_symbol", "ensembl_transcript_id",  :
  The query to the BioMart webservice returned an invalid result: the number of columns in the result table does not equal the number of attributes in the query. Please report this to the mailing list.


Could you please help me solve it? Is it maybe because I do a genomeWide query?

Thank you very much!
Eleni

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Error in getBM

Eleni Christodoulou
Dear Thomas,

Thank you very much for your explanatory reply. Very insightful! It worked :)
I was wondering if there is a way to get the upstream and downstream flanking of a given Ensembl transcript. It seems that getSequence receives only chromosomes, start and end position of the gene as input.

Thank you very much!
Eleni

On Thursday, October 27, 2016 at 4:48:31 PM UTC+8, Thomas Maurel wrote:
Dear Eleni,

I am afraid there are three issues here.
The first one is indeed that you are doing a genome wide query and that the BioMart software is not designed to handle these type of queries.
Could you please split your query in smaller chunks using a filter, for example you can run one query for each chromosome.
The second issue is that you can only query one sequence type at a time, so you should split this query into two, one for coding sequences and one for coding_transcript_flank, e.g:

> drerio_coding_chr1 = getBM(attributes=c(“hgnc_symbol",'ensembl_transcript_id','coding'),filters ='chromosome_name', values ="1", mart=mart)

Finally, the “coding_transcript_flank” sequence must be accompanied by an upstream_flank or downstream_flank request to work, e.g:

> drerio_flanking_all_genes_chr1_upstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",upstream=100, mart=mart)
> drerio_flanking_all_genes_chr1_downstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",downstream=100, mart=mart)

I hope this helps,
Best Regards,
Thomas
On 27 Oct 2016, at 05:07, Eleni Christodoulou <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="NQqts4fKCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">elen...@...> wrote:

Dear Biomart community,

I am trying to retrieve some information for the dario-rerio genes (zebrafish). This is my code

library(biomaRt)
if(interactive()){
  mart = useMart("ENSEMBL_MART_ENSEMBL", dataset="drerio_gene_ensembl")
}
drerio_coding_and_flanking_all_genes = getBM(attributes=c("hgnc_symbol",'ensembl_transcript_id','coding','coding_transcript_flank'), mart=mart)

     
After some minutes, I get the following error
Error in getBM(attributes = c("hgnc_symbol", "ensembl_transcript_id",  :
  The query to the BioMart webservice returned an invalid result: the number of columns in the result table does not equal the number of attributes in the query. Please report this to the mailing list.


Could you please help me solve it? Is it maybe because I do a genomeWide query?

Thank you very much!
Eleni

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="NQqts4fKCAAJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">biomart-user...@googlegroups.com.
Visit this group at <a href="https://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/group/biomart-users&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/group/biomart-users&#39;;return true;">https://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;">https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] Error in getBM

Thomas Maurel
Dear Eleni,

No worries. Sure, you can do the following to retrieve the upstream or downstream flank of a given Ensembl transcript:

> drerio_flanking_all_genes_transcript_downstream_100 = getSequence(id="ENSDART00000089622",type="ensembl_transcript_id",seqType="coding_transcript_flank",downstream=100, mart=mart)
> drerio_flanking_all_genes_transcript_downstream_100
                                                                               coding_transcript_flank
1 TTTAGTTAAGTATATAATGATTTTTGGCATAACTGCAAAATTGTTATGTATATTCTGTTGTTTACTGCACTCATACTGGTCTACCATTGTTTGCCTACAA
  ensembl_transcript_id
1    ENSDART00000089622

Hope this helps,
Regards,
Thomas
On 28 Oct 2016, at 03:03, Eleni Christodoulou <[hidden email]> wrote:

Dear Thomas,

Thank you very much for your explanatory reply. Very insightful! It worked :)
I was wondering if there is a way to get the upstream and downstream flanking of a given Ensembl transcript. It seems that getSequence receives only chromosomes, start and end position of the gene as input. 

Thank you very much!
Eleni

On Thursday, October 27, 2016 at 4:48:31 PM UTC+8, Thomas Maurel wrote:
Dear Eleni,

I am afraid there are three issues here.
The first one is indeed that you are doing a genome wide query and that the BioMart software is not designed to handle these type of queries.
Could you please split your query in smaller chunks using a filter, for example you can run one query for each chromosome.
The second issue is that you can only query one sequence type at a time, so you should split this query into two, one for coding sequences and one for coding_transcript_flank, e.g:

> drerio_coding_chr1 = getBM(attributes=c(“hgnc_symbol",'ensembl_transcript_id','coding'),filters ='chromosome_name', values ="1", mart=mart)

Finally, the “coding_transcript_flank” sequence must be accompanied by an upstream_flank or downstream_flank request to work, e.g:

> drerio_flanking_all_genes_chr1_upstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",upstream=100, mart=mart)
> drerio_flanking_all_genes_chr1_downstream_100 = getSequence(chromosome=1,start=0,end=58871917,type=c(“hgnc_symbol",'ensembl_transcript_id'),seqType="coding_transcript_flank",downstream=100, mart=mart)

I hope this helps,
Best Regards,
Thomas
On 27 Oct 2016, at 05:07, Eleni Christodoulou <elen...@gmail.com> wrote:

Dear Biomart community,

I am trying to retrieve some information for the dario-rerio genes (zebrafish). This is my code

library(biomaRt)
if(interactive()){
  mart = useMart("ENSEMBL_MART_ENSEMBL", dataset="drerio_gene_ensembl")
}
drerio_coding_and_flanking_all_genes = getBM(attributes=c("hgnc_symbol",'ensembl_transcript_id','coding','coding_transcript_flank'), mart=mart)

      
After some minutes, I get the following error
Error in getBM(attributes = c("hgnc_symbol", "ensembl_transcript_id",  : 
  The query to the BioMart webservice returned an invalid result: the number of columns in the result table does not equal the number of attributes in the query. Please report this to the mailing list.


Could you please help me solve it? Is it maybe because I do a genomeWide query?

Thank you very much!
Eleni

-- 
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom


-- 
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.