[biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

classic Classic list List threaded Threaded
8 messages Options
Reply | Threaded
Open this post in threaded view
|

[biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Livingstone Fultang

I am running the biomart-perl script obtained from github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Arek Kasprzyk
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Livingstone Fultang
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: http://twitter.com/livingstonef 
linkedIn: http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="MdFJP5Snq14J" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;">livingsto...@...> wrote:

I am running the biomart-perl script obtained from <a href="https://github.com/biomart/biomart-perl" style="color:rgb(7,130,193)" target="_blank" onmousedown="this.href='https://www.google.com/url?q\75https%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\46sa\75D\46sntz\0751\46usg\75AFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;" onclick="this.href='https://www.google.com/url?q\75https%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\46sa\75D\46sntz\0751\46usg\75AFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;">github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="MdFJP5Snq14J" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;">biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Arek Kasprzyk
Hi,
I have just tried the first transcript using MView web insterface one and got the 5' upstream (i asked for 100bp)

>ENSG00000196517|ENST00000372310
CCCCCGCCTCCCCGAAACCAAAACACAACAGGCTGTGGAAGAGCTGCGAGCGGCGCGGCGGGGCGGGCGAACTCGGCGCGGCACAGAGCCTCGGGAGGCT

so in principle this should be working OK for you. I noticed that you are not setting the transcript_flank attribute. This is required if you need an upstream region and using a filter 'upstream flank'. Perhaps this might be an issue?




On 4 June 2014 11:58, Livingstone Fultang <[hidden email]> wrote:
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: <a href="tel:%2B44%20%280%29%20191%20222%207772" value="+441912227772" target="_blank">+44 (0) 191 222 7772

twitter: http://twitter.com/livingstonef 
linkedIn: http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Livingstone Fultang
Hi Arek

I think there is definitely an issue with the Perl API. I am able to retrieve the sequences from mart view either on biomart.org or the one hosted on ensembl. However even if I add the 'transcript_flank' to the perl script as below and request a 100pb upstream flank, I still do not get an output with the BioMart Perl API. Also what is the difference between the 'coding_transcript_flank' and 'transcript_flank'  attributes (I am assuming there is)? 

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["100"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

--------------------------------
Livingstone Fultang,
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: http://twitter.com/livingstonef 
linkedIn: http://uk.linkedin.com/in/livingstonef



On Wednesday, 4 June 2014 11:31:43 UTC+1, Arek Kasprzyk wrote:
Hi,
I have just tried the first transcript using MView web insterface one and got the 5' upstream (i asked for 100bp)

>ENSG00000196517|ENST00000372310
CCCCCGCCTCCCCGAAACCAAAACACAACAGGCTGTGGAAGAGCTGCGAGCGGCGCGGCGGGGCGGGCGAACTCGGCGCGGCACAGAGCCTCGGGAGGCT

so in principle this should be working OK for you. I noticed that you are not setting the transcript_flank attribute. This is required if you need an upstream region and using a filter 'upstream flank'. Perhaps this might be an issue?




On 4 June 2014 11:58, Livingstone Fultang <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="i4ccwXvM0csJ" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;">livingsto...@...> wrote:
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: <a href="http://twitter.com/livingstonef" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Ftwitter.com%2Flivingstonef\46sa\75D\46sntz\0751\46usg\75AFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Ftwitter.com%2Flivingstonef\46sa\75D\46sntz\0751\46usg\75AFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;">http://twitter.com/livingstonef 
linkedIn: <a href="http://uk.linkedin.com/in/livingstonef" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\46sa\75D\46sntz\0751\46usg\75AFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\46sa\75D\46sntz\0751\46usg\75AFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;">http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from <a href="https://github.com/biomart/biomart-perl" style="color:rgb(7,130,193)" target="_blank" onmousedown="this.href='https://www.google.com/url?q\75https%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\46sa\75D\46sntz\0751\46usg\75AFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;" onclick="this.href='https://www.google.com/url?q\75https%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\46sa\75D\46sntz\0751\46usg\75AFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;">github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" onmousedown="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\75http%3A%2F%2Fwww.biomart.org\46sa\75D\46sntz\0751\46usg\75AFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.

Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="i4ccwXvM0csJ" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;">biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Arek Kasprzyk
hmm ... The perl API should be definitely working because this is what MView is using 'under the hood'. I think we maybe not using it properly. One thing that i want you to try is to remove one of the 'flank attributes'. I think you can only use one at a time (just like MView). The difference is between the two (transcript_flank and coding_transcript_flank) is that the first one will start pulling flanking sequence outside UTR, while the other will include UTR in the flank sequence. We have some java script images in MView to help understand this difference a bit better.

a




On 4 June 2014 13:56, Livingstone Fultang <[hidden email]> wrote:
Hi Arek

I think there is definitely an issue with the Perl API. I am able to retrieve the sequences from mart view either on biomart.org or the one hosted on ensembl. However even if I add the 'transcript_flank' to the perl script as below and request a 100pb upstream flank, I still do not get an output with the BioMart Perl API. Also what is the difference between the 'coding_transcript_flank' and 'transcript_flank'  attributes (I am assuming there is)? 

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);

$query
->addFilter("upstream_flank", ["100"]);

$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");

$query
->addAttribute("transcript_flank");

$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

--------------------------------
Livingstone Fultang,
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: <a href="tel:%2B44%20%280%29%20191%20222%207772" value="+441912227772" target="_blank">+44 (0) 191 222 7772

twitter: http://twitter.com/livingstonef 
linkedIn: http://uk.linkedin.com/in/livingstonef



On Wednesday, 4 June 2014 11:31:43 UTC+1, Arek Kasprzyk wrote:
Hi,
I have just tried the first transcript using MView web insterface one and got the 5' upstream (i asked for 100bp)

>ENSG00000196517|ENST00000372310
CCCCCGCCTCCCCGAAACCAAAACACAACAGGCTGTGGAAGAGCTGCGAGCGGCGCGGCGGGGCGGGCGAACTCGGCGCGGCACAGAGCCTCGGGAGGCT

so in principle this should be working OK for you. I noticed that you are not setting the transcript_flank attribute. This is required if you need an upstream region and using a filter 'upstream flank'. Perhaps this might be an issue?




On 4 June 2014 11:58, Livingstone Fultang <[hidden email]> wrote:
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: http://twitter.com/livingstonef 
linkedIn: http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at http://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

joe carlson
I'm just looking at some old threads today and noticed this.

this sounds to me like the bug in the client library that I had found.

https://groups.google.com/forum/#!topic/biomart-users/fnOBzM4FNak

It's an easy fix, but it needs to be done on the client. Was this updated in the distributed source?

On Wednesday, June 4, 2014 at 6:57:00 AM UTC-7, Arek Kasprzyk wrote:
hmm ... The perl API should be definitely working because this is what MView is using 'under the hood'. I think we maybe not using it properly. One thing that i want you to try is to remove one of the 'flank attributes'. I think you can only use one at a time (just like MView). The difference is between the two (transcript_flank and coding_transcript_flank) is that the first one will start pulling flanking sequence outside UTR, while the other will include UTR in the flank sequence. We have some java script images in MView to help understand this difference a bit better.

a




On 4 June 2014 13:56, Livingstone Fultang <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="iqvJ7fSXVboJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">livingsto...@...> wrote:
Hi Arek

I think there is definitely an issue with the Perl API. I am able to retrieve the sequences from mart view either on <a href="http://biomart.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fbiomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNE1siqa9dJkAfTSOKB7pDUMcuY2ew&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fbiomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNE1siqa9dJkAfTSOKB7pDUMcuY2ew&#39;;return true;">biomart.org or the one hosted on ensembl. However even if I add the 'transcript_flank' to the perl script as below and request a 100pb upstream flank, I still do not get an output with the BioMart Perl API. Also what is the difference between the 'coding_transcript_flank' and 'transcript_flank'  attributes (I am assuming there is)? 

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);

$query
->addFilter("upstream_flank", ["100"]);

$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");

$query
->addAttribute("transcript_flank");

$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

--------------------------------
Livingstone Fultang,
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: <a href="http://twitter.com/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg&#39;;return true;">http://twitter.com/livingstonef 
linkedIn: <a href="http://uk.linkedin.com/in/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g&#39;;return true;">http://uk.linkedin.com/in/livingstonef



On Wednesday, 4 June 2014 11:31:43 UTC+1, Arek Kasprzyk wrote:
Hi,
I have just tried the first transcript using MView web insterface one and got the 5' upstream (i asked for 100bp)

>ENSG00000196517|ENST00000372310
CCCCCGCCTCCCCGAAACCAAAACACAACAGGCTGTGGAAGAGCTGCGAGCGGCGCGGCGGGGCGGGCGAACTCGGCGCGGCACAGAGCCTCGGGAGGCT

so in principle this should be working OK for you. I noticed that you are not setting the transcript_flank attribute. This is required if you need an upstream region and using a filter 'upstream flank'. Perhaps this might be an issue?




On 4 June 2014 11:58, Livingstone Fultang <[hidden email]> wrote:
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: <a href="http://twitter.com/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg&#39;;return true;">http://twitter.com/livingstone
linkedIn: <a href="http://uk.linkedin.com/in/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g&#39;;return true;">http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from <a href="https://github.com/biomart/biomart-perl" style="color:rgb(7,130,193)" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA&#39;;return true;" onclick="this.href=&#39;https://www.google.com/url?q\x3dhttps%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA&#39;;return true;">github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;" onclick="this.href=&#39;http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w&#39;;return true;">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");

I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.

Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;" onclick="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;" onclick="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="iqvJ7fSXVboJ" rel="nofollow" onmousedown="this.href=&#39;javascript:&#39;;return true;" onclick="this.href=&#39;javascript:&#39;;return true;">biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;" onclick="this.href=&#39;http://groups.google.com/group/biomart-users&#39;;return true;">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;" onclick="this.href=&#39;https://groups.google.com/d/optout&#39;;return true;">https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.
Reply | Threaded
Open this post in threaded view
|

Re: [biomart-users] I Can't retrieve the 5'upstream regions of specific transcript Biomart Perl. But can retrieve 5'UTR

Thomas Maurel
Hello,

Thanks a lot for the fix and sorry for not letting you know about the fix being live.

Hope this helps,
Best Regards,
Thomas
On 18 May 2016, at 00:14, [hidden email] wrote:

I'm just looking at some old threads today and noticed this.

this sounds to me like the bug in the client library that I had found.

https://groups.google.com/forum/#!topic/biomart-users/fnOBzM4FNak

It's an easy fix, but it needs to be done on the client. Was this updated in the distributed source?

On Wednesday, June 4, 2014 at 6:57:00 AM UTC-7, Arek Kasprzyk wrote:
hmm ... The perl API should be definitely working because this is what MView is using 'under the hood'. I think we maybe not using it properly. One thing that i want you to try is to remove one of the 'flank attributes'. I think you can only use one at a time (just like MView). The difference is between the two (transcript_flank and coding_transcript_flank) is that the first one will start pulling flanking sequence outside UTR, while the other will include UTR in the flank sequence. We have some java script images in MView to help understand this difference a bit better.

a




On 4 June 2014 13:56, Livingstone Fultang <<a href="javascript:" target="_blank" gdf-obfuscated-mailto="iqvJ7fSXVboJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class="">livingsto...@...> wrote:
Hi Arek

I think there is definitely an issue with the Perl API. I am able to retrieve the sequences from mart view either on <a href="http://biomart.org/" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fbiomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNE1siqa9dJkAfTSOKB7pDUMcuY2ew';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fbiomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNE1siqa9dJkAfTSOKB7pDUMcuY2ew';return true;" class="">biomart.org or the one hosted on ensembl. However even if I add the 'transcript_flank' to the perl script as below and request a 100pb upstream flank, I still do not get an output with the BioMart Perl API. Also what is the difference between the 'coding_transcript_flank' and 'transcript_flank'  attributes (I am assuming there is)? 

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);

$query
->addFilter("upstream_flank", ["100"]);

$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");

$query
->addAttribute("transcript_flank");

$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

--------------------------------
Livingstone Fultang,
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: <a href="http://twitter.com/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;" class="">http://twitter.com/livingstonef 
linkedIn: <a href="http://uk.linkedin.com/in/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;" class="">http://uk.linkedin.com/in/livingstonef



On Wednesday, 4 June 2014 11:31:43 UTC+1, Arek Kasprzyk wrote:
Hi,
I have just tried the first transcript using MView web insterface one and got the 5' upstream (i asked for 100bp)

>ENSG00000196517|ENST00000372310
CCCCCGCCTCCCCGAAACCAAAACACAACAGGCTGTGGAAGAGCTGCGAGCGGCGCGGCGGGGCGGGCGAACTCGGCGCGGCACAGAGCCTCGGGAGGCT

so in principle this should be working OK for you. I noticed that you are not setting the transcript_flank attribute. This is required if you need an upstream region and using a filter 'upstream flank'. Perhaps this might be an issue?




On 4 June 2014 11:58, Livingstone Fultang <[hidden email]> wrote:
Hi Arek

Thanks for your reply. I have tried the same for the following transcripts with no success

my %transcripts =
 
("hsapiens_gene_ensembl","ENST00000372310",
 
"amelanoleuca_gene_ensembl","ENSAMET00000001148",
 
"acarolinensis_gene_ensembl","ENSACAT00000014677",
 
"amexicanus_gene_ensembl","ENSAMXT00000012594",
 
"btaurus_gene_ensembl","ENSBTAT00000011456",
 
"btaurus_gene_ensembl","ENSBTAT00000011454",
 
"cjacchus_gene_ensembl","ENSCJAT00000007493",
 
"cfamiliaris_gene_ensembl","ENSCAFT00000007773",
 
"cporcellus_gene_ensembl","ENSCPOT00000013734",
 
"drerio_gene_ensembl","ENSDART00000077462",
 
"dnovemcinctus_gene_ensembl","ENSDNOT00000043792",
 
"dordii_gene_ensembl","ENSDORT00000005474",
 
"etelfairi_gene_ensembl","ENSETET00000018377",
 
"ecaballus_gene_ensembl","ENSECAT00000005457",
 
"eeuropaeus_gene_ensembl","ENSEEUT00000002027",
 
"fcatus_gene_ensembl","ENSFCAT00000006495",
 
"falbicollis_gene_ensembl","ENSFALT00000005539",
 
"ggallus_gene_ensembl","ENSGALT00000038518",
 
"gaculeatus_gene_ensembl","ENSGACT00000019111",
 
"ggorilla_gene_ensembl","ENSGGOT00000003674",
 
"itridecemlineatus_gene_ensembl","ENSSTOT00000004456",
 
"lchalumnae_gene_ensembl","ENSLACT00000004601",
 
"loculatus_gene_ensembl","ENSLOCT00000003165",
 
"lafricana_gene_ensembl","ENSLAFT00000000144",
 
"mmulatta_gene_ensembl","ENSMMUT00000021254",
 
"meugenii_gene_ensembl","ENSMEUT00000015696",
 
"mgallopavo_gene_ensembl","ENSMGAT00000011249",
 
"mmurinus_gene_ensembl","ENSMICT00000011036",
 
"mdomestica_gene_ensembl","ENSMODT00000039267",
 
"mmusculus_gene_ensembl","ENSMUST00000030269",
 
"mfuro_gene_ensembl","ENSMPUT00000013686",
 
"nleucogenys_gene_ensembl","ENSNLET00000017767",
 
"oprinceps_gene_ensembl","ENSOPRT00000013813",
 
"oniloticus_gene_ensembl","ENSONIT00000011406",
 
"oanatinus_gene_ensembl","ENSOANT00000021747",
 
"ocuniculus_gene_ensembl","ENSOCUT00000031972",
 
"olatipes_gene_ensembl","ENSORLT00000015683",
 
"ogarnettii_gene_ensembl","ENSOGAT00000001183",
 
"oaries_gene_ensembl","ENSOART00000000788",
 
"ptroglodytes_gene_ensembl","ENSPTRT00000047245",
 
"pabelii_gene_ensembl","ENSPPYT00000001719",
 
"pcapensis_gene_ensembl","ENSPCAT00000012781",
 
"pvampyrus_gene_ensembl","ENSPVAT00000009510",
 
"rnorvegicus_gene_ensembl","ENSRNOT00000048770",
 
"sharrisii_gene_ensembl","ENSSHAT00000007664",
 
"tguttata_gene_ensembl","ENSTGUT00000007899",
 
"trubripes_gene_ensembl","ENSTRUT00000001360",
 
"tsyrichta_gene_ensembl","ENSTSYT00000012738",
 
"tnigroviridis_gene_ensembl","ENSTNIT00000002211",
 
"tbelangeri_gene_ensembl","ENSTBET00000004291",
 
"ttruncatus_gene_ensembl","ENSTTRT00000001295",
 
"xtropicalis_gene_ensembl","ENSXETT00000007095",
 
"xmaculatus_gene_ensembl","ENSXMAT00000019205");

--------------------------------
Livingstone Fultang, 
Epithelial Research Group
Institute for Cell & Molecular Bio-sciences (ICAMB)
Newcastle University, Medical School
Cookson Building
Newcastle upon Tyne 
United Kingdom
NE2 4HH

Tel: +44 (0) 191 222 7772

twitter: <a href="http://twitter.com/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Ftwitter.com%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGwhmHgd6tYlY8LPWDOPJPn_bl2gg';return true;" class="">http://twitter.com/livingstone
linkedIn: <a href="http://uk.linkedin.com/in/livingstonef" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fuk.linkedin.com%2Fin%2Flivingstonef\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNEOAVacAYCwoBJzr3E_otr3cEOG-g';return true;" class="">http://uk.linkedin.com/in/livingstonef

On Wednesday, 4 June 2014 08:51:25 UTC+1, Arek Kasprzyk wrote:
Hi,
are you experiencing the same problems with other transcripts or is it just this one in particular?


a


On 22 May 2014 10:00, Livingstone Fultang <[hidden email]> wrote:

I am running the biomart-perl script obtained from <a href="https://github.com/biomart/biomart-perl" style="color:rgb(7,130,193)" target="_blank" rel="nofollow" onmousedown="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;" onclick="this.href='https://www.google.com/url?q\x3dhttps%3A%2F%2Fgithub.com%2Fbiomart%2Fbiomart-perl\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNFSCkIJxABHnbSxuPEm8piHmuvOFA';return true;" class="">github (If it matters i am using Perl v5.12.4). All Biomart-perl dependencies are installed and everything seems to be working fine. 

EXCEPT..

I am having issues obtaining 5'upstream region of the longest transcript (Ensembl ID ENST00000372310) of the HSAPI SLC6A9 gene using the biomart-perl api. I simply do not get any output when using the perl script obtained from BioMart web interface which includes

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addFilter("upstream_flank", ["2000"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("coding_transcript_flank");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");

And using the following registry file

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE MartRegistry>
<MartRegistry>
   
<MartURLLocation
       
database="ensembl_mart_75"
       
default="1"
       
displayName="ENSEMBL GENES 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org/" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" class="">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="ensembl"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />

   
<MartURLLocation
       
database="sequence_mart_75"
       
default="0"
       
displayName="ENSEMBL SEQUENCE 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org/" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" class="">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="sequence"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="0" />
     
   
<MartURLLocation
       
database="snp_mart_75"
       
default="0"
       
displayName="ENSEMBL VARIATION 75 (SANGER UK)"
       
host="<a href="http://www.biomart.org/" target="_blank" rel="nofollow" onmousedown="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" onclick="this.href='http://www.google.com/url?q\x3dhttp%3A%2F%2Fwww.biomart.org\x26sa\x3dD\x26sntz\x3d1\x26usg\x3dAFQjCNGTycqpJiNkOBMw43z-5DeV4RRH3w';return true;" class="">www.biomart.org"
       
includeDatasets=""
       
martUser=""
       
name="snp"
       
path="/biomart/martservice"
       
port="80"
       
serverVirtualSchema="default"
       
visible="1" />
           
</MartRegistry>


However using the same registry as above, and the following, I am able to get the FASTA output for 5UTR of the transcript

$query->setDataset("hsapiens_gene_ensembl");
$query
->addFilter("ensembl_transcript_id", ["ENST00000372310"]);
$query
->addAttribute("ensembl_gene_id");
$query
->addAttribute("ensembl_transcript_id");
$query
->addAttribute("external_gene_id");
$query
->addAttribute("strand");
$query
->addAttribute("5utr");


I am not really sure what I am missing in order to get the 5'flanking (upstream) of the individual transcript. anything wrong with my registry file? 


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.

Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;" class="">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;" class="">https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;" class="">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;" class="">https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to <a href="javascript:" target="_blank" gdf-obfuscated-mailto="iqvJ7fSXVboJ" rel="nofollow" onmousedown="this.href='javascript:';return true;" onclick="this.href='javascript:';return true;" class="">biomart-user...@googlegroups.com.
Visit this group at <a href="http://groups.google.com/group/biomart-users" target="_blank" rel="nofollow" onmousedown="this.href='http://groups.google.com/group/biomart-users';return true;" onclick="this.href='http://groups.google.com/group/biomart-users';return true;" class="">http://groups.google.com/group/biomart-users.
For more options, visit <a href="https://groups.google.com/d/optout" target="_blank" rel="nofollow" onmousedown="this.href='https://groups.google.com/d/optout';return true;" onclick="this.href='https://groups.google.com/d/optout';return true;" class="">https://groups.google.com/d/optout.


--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.

--
Thomas Maurel
Bioinformatician - Ensembl Production Team
European Bioinformatics Institute (EMBL-EBI)
European Molecular Biology Laboratory
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
United Kingdom

--
You received this message because you are subscribed to the Google Groups "biomart-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to [hidden email].
Visit this group at https://groups.google.com/group/biomart-users.
For more options, visit https://groups.google.com/d/optout.