errors loading fasta

classic Classic list List threaded Threaded
7 messages Options
Reply | Threaded
Open this post in threaded view
|

errors loading fasta

Sofia Robb
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia

------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

Stephen Ficklin-2
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen

On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

Sofia Robb
Hi Stephen,

Updating to the development code fixed my fasta load issues!! Thanks!

Now I tried to load a gff and have some more errors. It looks like it has something to do with the phase of CDS features. Do I need phase info, are '.'s not allowed?

scaffold_1      transdecoder  gene             1        4811     .  -  .  ID=TCONS_00000001|g.1385;Name=TCONS_00000001|g.13
scaffold_1      transdecoder  mRNA             1        4811     .  -  .  ID=TCONS_00000001|m.1385;Parent=TCONS_00000001|g.
scaffold_1      transdecoder  five_prime_UTR   1303     4811     .  -  .  ID=TCONS_00000001|m.1385.utr5p1;Parent=TCONS_0000
scaffold_1      transdecoder  exon             1        4811     .  -  .  ID=TCONS_00000001|m.1385.exon1;Parent=TCONS_00000
scaffold_1      transdecoder  CDS              949      1302     .  -  .  ID=cds.TCONS_00000001|m.1385;Parent=TCONS_0000000
 
Looks like it might be failing on my very first CDS feature.
 

Tripal Job Launcher
Running as user 'administrator'
-------------------
Calling: tripal_feature_load_gff3(/data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3, 14, 21, 0, 1, 0, 0, 1, , , 0, , , , 0, 144)

NOTE: Loading of this GFF file is performed using a database transaction.
If the load fails or is terminated prematurely then the entire set of
insertions/updates is rolled back and will not be found in the database

Opening /data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3
Parsing Line 0 (0.00%). Memory: 29,402,968 bytes
FAILED: Rolling back database changes...
WD tripal_feature: PDOException: SQLSTATE[22P02]: Invalid text representation: 7 ERROR:  invalid input syntax   [error]
for integer: ""
LINE 1: ...hase) VALUES ('8585308', '8585305', '948', '1302', '-1', '')
                                                                    ^: INSERT INTO chado.tripal_gffcds_temp
(feature_id, parent_id, fmin, fmax, strand, phase) VALUES (:feature_id, :parent_id, :fmin, :fmax, :strand,
:phase); Array
(
    [:feature_id] => 8585308
    [:parent_id] => 8585305
    [:fmin] => 948
    [:fmax] => 1302
    [:strand] => -1
    [:phase] =>
)
 in chado_query() (line 1510 of
/var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.chado_query.api.inc).

On Fri, Nov 6, 2015 at 5:35 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen


On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal



------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

Stephen Ficklin-2
Hi Sofia,

Yes, the problem is indeed with the missing phase for the CDS.    According to the GFF3 specification (http://www.sequenceontology.org/gff3.shtml) the phase is required for CDS features and the Tripal GFF loader will fail if it's not there.  The loader will also try to generate a protein sequence using the CDSs and therefore needs the phase information.   

Can you get that phase info into your GFF file?

Thanks for your patience for this reply.
Stephen

On Fri, Nov 6, 2015 at 8:11 PM, Sofia Robb <[hidden email]> wrote:
Hi Stephen,

Updating to the development code fixed my fasta load issues!! Thanks!

Now I tried to load a gff and have some more errors. It looks like it has something to do with the phase of CDS features. Do I need phase info, are '.'s not allowed?

scaffold_1      transdecoder  gene             1        4811     .  -  .  ID=TCONS_00000001|g.1385;Name=TCONS_00000001|g.13
scaffold_1      transdecoder  mRNA             1        4811     .  -  .  ID=TCONS_00000001|m.1385;Parent=TCONS_00000001|g.
scaffold_1      transdecoder  five_prime_UTR   1303     4811     .  -  .  ID=TCONS_00000001|m.1385.utr5p1;Parent=TCONS_0000
scaffold_1      transdecoder  exon             1        4811     .  -  .  ID=TCONS_00000001|m.1385.exon1;Parent=TCONS_00000
scaffold_1      transdecoder  CDS              949      1302     .  -  .  ID=cds.TCONS_00000001|m.1385;Parent=TCONS_0000000
 
Looks like it might be failing on my very first CDS feature.
 

Tripal Job Launcher
Running as user 'administrator'
-------------------
Calling: tripal_feature_load_gff3(/data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3, 14, 21, 0, 1, 0, 0, 1, , , 0, , , , 0, 144)

NOTE: Loading of this GFF file is performed using a database transaction.
If the load fails or is terminated prematurely then the entire set of
insertions/updates is rolled back and will not be found in the database

Opening /data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3
Parsing Line 0 (0.00%). Memory: 29,402,968 bytes
FAILED: Rolling back database changes...
WD tripal_feature: PDOException: SQLSTATE[22P02]: Invalid text representation: 7 ERROR:  invalid input syntax   [error]
for integer: ""
LINE 1: ...hase) VALUES ('8585308', '8585305', '948', '1302', '-1', '')
                                                                    ^: INSERT INTO chado.tripal_gffcds_temp
(feature_id, parent_id, fmin, fmax, strand, phase) VALUES (:feature_id, :parent_id, :fmin, :fmax, :strand,
:phase); Array
(
    [:feature_id] => 8585308
    [:parent_id] => 8585305
    [:fmin] => 948
    [:fmax] => 1302
    [:strand] => -1
    [:phase] =>
)
 in chado_query() (line 1510 of
/var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.chado_query.api.inc).

On Fri, Nov 6, 2015 at 5:35 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen


On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal




------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

Sofia Robb
I used transdecoder to go from a cufflinks gtf to a gff3 with CDS. It didnt include phase.  I will try to figure out how to get it in there. 

Thanks!
Sofia

On Wed, Nov 11, 2015 at 10:14 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

Yes, the problem is indeed with the missing phase for the CDS.    According to the GFF3 specification (http://www.sequenceontology.org/gff3.shtml) the phase is required for CDS features and the Tripal GFF loader will fail if it's not there.  The loader will also try to generate a protein sequence using the CDSs and therefore needs the phase information.   

Can you get that phase info into your GFF file?

Thanks for your patience for this reply.
Stephen

On Fri, Nov 6, 2015 at 8:11 PM, Sofia Robb <[hidden email]> wrote:
Hi Stephen,

Updating to the development code fixed my fasta load issues!! Thanks!

Now I tried to load a gff and have some more errors. It looks like it has something to do with the phase of CDS features. Do I need phase info, are '.'s not allowed?

scaffold_1      transdecoder  gene             1        4811     .  -  .  ID=TCONS_00000001|g.1385;Name=TCONS_00000001|g.13
scaffold_1      transdecoder  mRNA             1        4811     .  -  .  ID=TCONS_00000001|m.1385;Parent=TCONS_00000001|g.
scaffold_1      transdecoder  five_prime_UTR   1303     4811     .  -  .  ID=TCONS_00000001|m.1385.utr5p1;Parent=TCONS_0000
scaffold_1      transdecoder  exon             1        4811     .  -  .  ID=TCONS_00000001|m.1385.exon1;Parent=TCONS_00000
scaffold_1      transdecoder  CDS              949      1302     .  -  .  ID=cds.TCONS_00000001|m.1385;Parent=TCONS_0000000
 
Looks like it might be failing on my very first CDS feature.
 

Tripal Job Launcher
Running as user 'administrator'
-------------------
Calling: tripal_feature_load_gff3(/data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3, 14, 21, 0, 1, 0, 0, 1, , , 0, , , , 0, 144)

NOTE: Loading of this GFF file is performed using a database transaction.
If the load fails or is terminated prematurely then the entire set of
insertions/updates is rolled back and will not be found in the database

Opening /data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3
Parsing Line 0 (0.00%). Memory: 29,402,968 bytes
FAILED: Rolling back database changes...
WD tripal_feature: PDOException: SQLSTATE[22P02]: Invalid text representation: 7 ERROR:  invalid input syntax   [error]
for integer: ""
LINE 1: ...hase) VALUES ('8585308', '8585305', '948', '1302', '-1', '')
                                                                    ^: INSERT INTO chado.tripal_gffcds_temp
(feature_id, parent_id, fmin, fmax, strand, phase) VALUES (:feature_id, :parent_id, :fmin, :fmax, :strand,
:phase); Array
(
    [:feature_id] => 8585308
    [:parent_id] => 8585305
    [:fmin] => 948
    [:fmax] => 1302
    [:strand] => -1
    [:phase] =>
)
 in chado_query() (line 1510 of
/var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.chado_query.api.inc).

On Fri, Nov 6, 2015 at 5:35 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen


On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal





------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

vkrishna
Hi Sofia,

One suggestion to add phase information to your GFF3 would be to pipe it through genometools (gt gff3, http://www.genometools.org/tools/gt_gff3.html), which can sort, clean, and perform some sanity checks on your GFF3 (for example, ensuring there are no ID clashes, source information is correct for child and parent, CDS features have phase info, etc.)

The command line would be something like:
gt gff3 -sort -tidy -retainids -addids no transdecoder.gff3 > transdecoder.withphase.gff3

Hope this helps!

Thank you.
Vivek

On Nov 12, 2015, at 9:39 AM, Sofia Robb <[hidden email]> wrote:

I used transdecoder to go from a cufflinks gtf to a gff3 with CDS. It didnt include phase.  I will try to figure out how to get it in there. 

Thanks!
Sofia

On Wed, Nov 11, 2015 at 10:14 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

Yes, the problem is indeed with the missing phase for the CDS.    According to the GFF3 specification (http://www.sequenceontology.org/gff3.shtml) the phase is required for CDS features and the Tripal GFF loader will fail if it's not there.  The loader will also try to generate a protein sequence using the CDSs and therefore needs the phase information.   

Can you get that phase info into your GFF file?

Thanks for your patience for this reply.
Stephen

On Fri, Nov 6, 2015 at 8:11 PM, Sofia Robb <[hidden email]> wrote:
Hi Stephen,

Updating to the development code fixed my fasta load issues!! Thanks!

Now I tried to load a gff and have some more errors. It looks like it has something to do with the phase of CDS features. Do I need phase info, are '.'s not allowed?

scaffold_1      transdecoder  gene             1        4811     .  -  .  ID=TCONS_00000001|g.1385;Name=TCONS_00000001|g.13
scaffold_1      transdecoder  mRNA             1        4811     .  -  .  ID=TCONS_00000001|m.1385;Parent=TCONS_00000001|g.
scaffold_1      transdecoder  five_prime_UTR   1303     4811     .  -  .  ID=TCONS_00000001|m.1385.utr5p1;Parent=TCONS_0000
scaffold_1      transdecoder  exon             1        4811     .  -  .  ID=TCONS_00000001|m.1385.exon1;Parent=TCONS_00000
scaffold_1      transdecoder  CDS              949      1302     .  -  .  ID=cds.TCONS_00000001|m.1385;Parent=TCONS_0000000
 
Looks like it might be failing on my very first CDS feature.
 

Tripal Job Launcher
Running as user 'administrator'
-------------------
Calling: tripal_feature_load_gff3(/data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3, 14, 21, 0, 1, 0, 0, 1, , , 0, , , , 0, 144)

NOTE: Loading of this GFF file is performed using a database transaction.
If the load fails or is terminated prematurely then the entire set of
insertions/updates is rolled back and will not be found in the database

Opening /data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3
Parsing Line 0 (0.00%). Memory: 29,402,968 bytes
FAILED: Rolling back database changes...
WD tripal_feature: PDOException: SQLSTATE[22P02]: Invalid text representation: 7 ERROR:  invalid input syntax   [error]
for integer: ""
LINE 1: ...hase) VALUES ('8585308', '8585305', '948', '1302', '-1', '')
                                                                    ^: INSERT INTO chado.tripal_gffcds_temp
(feature_id, parent_id, fmin, fmax, strand, phase) VALUES (:feature_id, :parent_id, :fmin, :fmax, :strand,
:phase); Array
(
    [:feature_id] => 8585308
    [:parent_id] => 8585305
    [:fmin] => 948
    [:fmax] => 1302
    [:strand] => -1
    [:phase] =>
)
 in chado_query() (line 1510 of
/var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.chado_query.api.inc).

On Fri, Nov 6, 2015 at 5:35 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen


On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal




------------------------------------------------------------------------------
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal
Reply | Threaded
Open this post in threaded view
|

Re: errors loading fasta

Sofia Robb
Thanks! I wrote my own phase calculator before I got your great idea of using gt. I ended up using gt as a check for my calculations, and they look good! Thank you again!

Sofia

On Thu, Nov 12, 2015 at 7:43 AM, Krishnakumar, Vivek <[hidden email]> wrote:
Hi Sofia,

One suggestion to add phase information to your GFF3 would be to pipe it through genometools (gt gff3, http://www.genometools.org/tools/gt_gff3.html), which can sort, clean, and perform some sanity checks on your GFF3 (for example, ensuring there are no ID clashes, source information is correct for child and parent, CDS features have phase info, etc.)

The command line would be something like:
gt gff3 -sort -tidy -retainids -addids no transdecoder.gff3 > transdecoder.withphase.gff3

Hope this helps!

Thank you.
Vivek

On Nov 12, 2015, at 9:39 AM, Sofia Robb <[hidden email]> wrote:

I used transdecoder to go from a cufflinks gtf to a gff3 with CDS. It didnt include phase.  I will try to figure out how to get it in there. 

Thanks!
Sofia

On Wed, Nov 11, 2015 at 10:14 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

Yes, the problem is indeed with the missing phase for the CDS.    According to the GFF3 specification (http://www.sequenceontology.org/gff3.shtml) the phase is required for CDS features and the Tripal GFF loader will fail if it's not there.  The loader will also try to generate a protein sequence using the CDSs and therefore needs the phase information.   

Can you get that phase info into your GFF file?

Thanks for your patience for this reply.
Stephen

On Fri, Nov 6, 2015 at 8:11 PM, Sofia Robb <[hidden email]> wrote:
Hi Stephen,

Updating to the development code fixed my fasta load issues!! Thanks!

Now I tried to load a gff and have some more errors. It looks like it has something to do with the phase of CDS features. Do I need phase info, are '.'s not allowed?

scaffold_1      transdecoder  gene             1        4811     .  -  .  ID=TCONS_00000001|g.1385;Name=TCONS_00000001|g.13
scaffold_1      transdecoder  mRNA             1        4811     .  -  .  ID=TCONS_00000001|m.1385;Parent=TCONS_00000001|g.
scaffold_1      transdecoder  five_prime_UTR   1303     4811     .  -  .  ID=TCONS_00000001|m.1385.utr5p1;Parent=TCONS_0000
scaffold_1      transdecoder  exon             1        4811     .  -  .  ID=TCONS_00000001|m.1385.exon1;Parent=TCONS_00000
scaffold_1      transdecoder  CDS              949      1302     .  -  .  ID=cds.TCONS_00000001|m.1385;Parent=TCONS_0000000
 
Looks like it might be failing on my very first CDS feature.
 

Tripal Job Launcher
Running as user 'administrator'
-------------------
Calling: tripal_feature_load_gff3(/data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3, 14, 21, 0, 1, 0, 0, 1, , , 0, , , , 0, 144)

NOTE: Loading of this GFF file is performed using a database transaction.
If the load fails or is terminated prematurely then the entire set of
insertions/updates is rolled back and will not be found in the database

Opening /data/organisms/nematostella/Nvec/genomes/Nvec_v1/align/CUFFLINKS.gff3
Parsing Line 0 (0.00%). Memory: 29,402,968 bytes
FAILED: Rolling back database changes...
WD tripal_feature: PDOException: SQLSTATE[22P02]: Invalid text representation: 7 ERROR:  invalid input syntax   [error]
for integer: ""
LINE 1: ...hase) VALUES ('8585308', '8585305', '948', '1302', '-1', '')
                                                                    ^: INSERT INTO chado.tripal_gffcds_temp
(feature_id, parent_id, fmin, fmax, strand, phase) VALUES (:feature_id, :parent_id, :fmin, :fmax, :strand,
:phase); Array
(
    [:feature_id] => 8585308
    [:parent_id] => 8585305
    [:fmin] => 948
    [:fmax] => 1302
    [:strand] => -1
    [:phase] =>
)
 in chado_query() (line 1510 of
/var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.chado_query.api.inc).

On Fri, Nov 6, 2015 at 5:35 PM, Stephen Ficklin <[hidden email]> wrote:
Hi Sofia,

I think I see where the problem may be but the line numbers on the error message don't line up with the current development code.  Can you update to the most recent development version and try to reload the FASTA file? If the problem still persists then I'll know exactly what lines the problems occur.

Thanks much,
Stephen


On 11/6/2015 3:34 PM, Sofia Robb wrote:
Hello Everyone,

When I load a fasta with Home » Administration » Tripal » Chado Data Loaders I get errors and my fasta doesn't load.

I didn't get these errors in the past when I loaded my fasta with the same version of tripal. I am not sure what has changed. But I did recently run drush pm-update. I don't remember what updated, but there was one or two packages.

First 2 lines of my fasta file: it looks fine to me.
>scaffold_1
ATTATATGCCCCAGTCTTGACGGGCCATCTGCAGCTTCTTTGCCGGCTGGTACAGCCCCTAGTCAAGCGA
AATGATGGTTTCCTCTCCGGGCAAGCAATCTTTGTCTTGATGTTCTGTGCTTGCATCAAAACTGTAAGCA

I get these errors:
[TRIPAL ERROR] (TRP-FASTA): Array
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 512 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 529 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 535 pid 6957
PHP Notice: Undefined offset: 1 in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 540 pid 6957
PHP Notice: Undefined variable: name in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 544 pid 6957
PHP Notice: Undefined variable: i in /var/www/sites/all/modules/tripal/tripal_feature/includes/tripal_feature.fasta_loader.inc on line 510 pid 6957
PHP Warning: array_keys() expects parameter 1 to be array, string given in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 117 pid 6957
PHP Notice: Array to string conversion in /var/www/sites/all/modules/tripal/tripal_core/api/tripal_core.tripal.api.inc on line 129 pid 6957

Thanks,
Sofia


------------------------------------------------------------------------------


_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal


------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal




------------------------------------------------------------------------------
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal



------------------------------------------------------------------------------

_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal