expressed_sequence_match and Targets

classic Classic list List threaded Threaded
1 message Options
Reply | Threaded
Open this post in threaded view
|

expressed_sequence_match and Targets

Sofia Robb
Hello All,

I have a question on how to use expressed_sequence_match and Target to get the match alignments to show up in the Target feature page.

I loaded up sequences of the Targets using the load fasta function, and I called these type transcript.
I then load the expressed_sequence_match via the gff loader. i indicate the target organism and the target type, transcript.

The matches do not seem to be connect at all to the Target feature. How do I format the gff so that the transcript feature, my target, will list its matches in the alignment tab? Right now no alignment tab shows up for either the transcript or expressed_sequence_match features.

Thanks,
Sofia

Here is my test set:
###FASTA#####
>SMED30010864
CACCCGGTTGATACAGTAATAAATCGAGAGGAAAAGAAACGAATCATGAGTCACACACATGGATTGCCCAAAAATCATCA
CAACAGACCACGAATCATTCATGATCGGCTCTATGACGAATAAATAGAGAAATCTGTAGGAACCCTGCGACATCAGAAAC
CTGGAGCAGTTATTTAGAGAAAGTTAATAAAACCAGTTACCTGAATTGCCTCCGATAATGAGAGATCCAAAATTGCGGAA
AATAATCCACGAAATGTCAGAAATAATTTCTAATATTCAGATCGATACAAAGAAATACATTAAATTGAATATGACACGTG
GCGAGAAAACAACCAGTTGATTCCAGATCAATAAGTCCCACGTCAGCAGGAAATTACTGATTAGAATGAATATAATACGC
ACACCAACTTGATCACCAACGCTGCCACACCTGCACAGTAGGCAAAGGAATATAAATAGATTGACTGGTGTAGACAATTT
TAGTCAATCACGATGAGTTGTAACACCAATTTCAATAGACAATGCAATGCGAGAACTCAAGGCCGTGCTTCCAATTCTCG
TGACGACGAAGAGATTACGATGAACCGACCAATTGCGCCAATAACTGTATCCGTGCCGAAGAAAGTTCTTCCAAGGAAGA
TGAGATCAGAAGCAAGAGAACATGGATCAGAATGGGGACACTCCTTTGCACGAAGAACAACAAGACCAAACTCGAAAAAC
TGTTACTCGCGATCTCGTTTTAATTGAATTTAGTGAAATAAATTATTCGGAATTTATTGTTTTTCGTACTTACATTTACT
CTCCTTAAACCGTTTTTCATACATCATACAATCTGTAGATTTTATTTTAACGCATTGGAAACACTAAATTAATGATAAAT
TAATTCCATATTAACCAACTGAACCTATTAATGGCTGTTTTATTGTAGAGAT


### GFF ( tried with the Names with and without the :\d)
v31.000184 est2genome:smed_20140614 expressed_sequence_match 80256 82615 3902 - . ID=v31.000184:hit:32173:3.2.0.0;Name=SMED30010864:1
v31.000184 est2genome:smed_20140614 match_part 82447 82615 3902 - . ID=v31.000184:hsp:71719:3.2.0.0;Parent=v31.000184:hit:32173:3.2.0.0;Target=SMED30010864 1 169 +;Gap=M169
v31.000184 est2genome:smed_20140614 match_part 82280 82392 3902 - . ID=v31.000184:hsp:71720:3.2.0.0;Parent=v31.000184:hit:32173:3.2.0.0;Target=SMED30010864 170 280 +;Gap=M59 D1 M30 D2 M8 I1 M13
v31.000184 est2genome:smed_20140614 match_part 81846 82145 3902 - . ID=v31.000184:hsp:71721:3.2.0.0;Parent=v31.000184:hit:32173:3.2.0.0;Target=SMED30010864 281 580 +;Gap=M300
v31.000184 est2genome:smed_20140614 match_part 80256 80604 3902 - . ID=v31.000184:hsp:71722:3.2.0.0;Parent=v31.000184:hit:32173:3.2.0.0;Target=SMED30010864 581 932 +;Gap=M199 I1 M32 I1 M30 I1 M88
v31.008456 est2genome:smed_20140614 expressed_sequence_match 11845 13020 3581 - . ID=v31.008456:hit:58365:3.2.0.0;Name=SMED30010864:2
v31.008456 est2genome:smed_20140614 match_part 12887 13020 3581 - . ID=v31.008456:hsp:119679:3.2.0.0;Parent=v31.008456:hit:58365:3.2.0.0;Target=SMED30010864 20 153 +;Gap=M134
v31.008456 est2genome:smed_20140614 match_part 12695 12832 3581 - . ID=v31.008456:hsp:119680:3.2.0.0;Parent=v31.008456:hit:58365:3.2.0.0;Target=SMED30010864 154 289 +;Gap=M96 D1 M9 D2 M8 I1 M22
v31.008456 est2genome:smed_20140614 match_part 12339 12628 3581 - . ID=v31.008456:hsp:119681:3.2.0.0;Parent=v31.008456:hit:58365:3.2.0.0;Target=SMED30010864 290 579 +;Gap=M290
v31.008456 est2genome:smed_20140614 match_part 11845 12194 3581 - . ID=v31.008456:hsp:119682:3.2.0.0;Parent=v31.008456:hit:58365:3.2.0.0;Target=SMED30010864 580 932 +;Gap=M1 D1 M199 I1 M32 I1 M29 I2 M88

------------------------------------------------------------------------------
What NetFlow Analyzer can do for you? Monitors network bandwidth and traffic
patterns at an interface-level. Reveals which users, apps, and protocols are
consuming the most bandwidth. Provides multi-vendor support for NetFlow,
J-Flow, sFlow and other flows. Make informed decisions using capacity planning
reports.http://sdm.link/zohodev2dev
_______________________________________________
Gmod-tripal mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-tripal