gbrowse visualization error

classic Classic list List threaded Threaded
6 messages Options
Reply | Threaded
Open this post in threaded view
|

gbrowse visualization error

JINGJING JIN-2
Dear all,

I have successfully installed GBrowse2 in my local computer and can run test data. 

However, when I try to load my example data using the method in tutorial.

Like this is my genome file:
>CalcuvA
TGCTAAACGAAACGATTTAGGGTTTCGTGGCATTTTTGTAAATAATATTTAGGACTCCAGGGGAGGACGC
CAGGAGAGCTCTCTCTAAAACCTATTGTTTTTGGTGTCTTGGTGTCCAATATATACTAAAAGCCTCTGGG
GAACACCAGGGGCAAAAGCGGCCATCCGCAATAATATTACCGGATGGCCGCGATTTTTTTGGTGTCTTGC
GTGGGACCACGCATTAAATGAAATCTAACCAATCACATGCCGCCTGACAAGGTTAGCTATTAAGGCTAAC
TGAGTGCGCTGTGGGCCTATATAAAGACATGTGATTTCAATTTATGCTTTACTTCGAAATGCCTAAGCGG
GATGCCCCGTGGCGTTCTATGGCGGGGACCTCTAAAGTGTCCCGCAATGCTAACTATTCACCTCGTGCAG
GTATGATCCATAAATTTGATAAGGCCGCTGCTTGGGTTAACAGGCCCATGTACAGGAAGCCCAGGATTTA
TAGGACGTTTAGAAGCCCAGATGTTCCTAGAGGCTGTGAAGGGCCTTGCAAAGTCCAGTCTTATGAGCAG
CGGCATGACATTTCCCATGTTGGTAAGGTCATGTGTATTTCAGACATAACACGTGGTAATGGTATTACCC
ATCGTGTTGGGAAGCGTTTTTGCGTCAAGTCCGTGTACATTTTGGGCAAGATATGGATGGACGAGAATAT
CAAGCTCAAGAACCACACCAACAGTGTCATGTTTTGGTTGGTTAGGGACAGAAGACCATATGGCACCCCT
ATGGAGTTTGGCCAAGTGTTCAACATGTTCGACAACGAGCCCAGTACTGCTACTGTGAAGAACGATCTTC
GTGATCGTTATCAAGTCATGCACAAGTTTTACGCAAAGGTAACCGGTGGGCAGTATGCGAGTAACGAGCA
GGCGTTGGTGAAGCGTTTTTGGAAGGTCAATAACTACGTTGTGTACAACCATCAAGAAGCAGGGAAATAC
GAGAATCATACGGAGAACGCTCTGTTATTGTATATGGCATGTACTCATGCCTCTAATCCTGTGTATGCGA
CATTAAAAATTCGGATCTATTTTTACGATTCGATAACAAATTAATAAATTTTGAAATTTATTACATGATT
CTCGTGAACATGAGTTACATAAGATCTGTCCGTTGCGAAACGAACAGCTCTAATTACATGATTAATACCA

This is the several line in my gff3 annotation file:

CalcuvA NCBI chromosome 1 2583 . . . ID=CalcuvA;Name=CalcuvA
CalcuvA NCBI gene 33 1567 . + . ID=AC1;Name=AC1
CalcuvA NCBI gene 339 1094 . + . ID=AV1;Name=AV1
CalcuvA NCBI gene 1091 1489 . - . ID=AC3;Name=AC3
CalcuvA NCBI gene 1236 1625 . - . ID=AC2;Name=AC2
CalcuvA NCBI gene 1567 2583 . - . ID=test1
CalcuvA NCBI gene 2172 2537 . - . ID=AC4;Name=AC4
CalcuvB NCBI chromosome 1 2513 . . . ID=CalcuvB;Name=CalcuvB
CalcuvB NCBI gene 529 1299 . + . ID=BV1;Name=BV1
CalcuvB NCBI gene 1357 2244 . - . ID=BC1;Name=BC1


I have use the bp_seqfeature_load.pl load successfully.

Becasue when check with the mysql database, I can see these feature is loaded successfully.
Of course, the privilege I also have grant to right people.

Then, I have add the conf file to global file.

[CalCuv]
description  = CalCuv database
path         = CalCuv.conf


For this CalCuv.conf, I also define it to my mysql database like this:

[GENERAL]
description   = CalCuv chromosomes
database      = annotations

[annotations:database]
db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -adaptor DBI::mysql
       -dsn    CalCuv
                -user    nobody


However, when  try to visualize it on gbrowse, like search CalcuvA:1..2,583, it display "NOT FOUND";

If search "AC1", it just display CalCuv database: 1bp from :.. on the title.

When I check with the log about Apache, it just say like this:

::1 - - [01/Aug/2013:10:47:36 -0400] "POST /cgi-bin/gb2/gbrowse/CalCuv/ HTTP/1.1" 200 6088 "http://localhost/cgi-bin/gb2/gbrowse/CalCuv/" "Mozilla/5.0 (X11; Ubuntu; Linux i686; rv:20.0) Gecko/20100101 Firefox/20.0"
::1 - - [01/Aug/2013:10:48:17 -0400] "GET /cgi-bin/gb2/gbrowse/CalCuv/?name=AC1 HTTP/1.1" 200 6169 "http://localhost/cgi-bin/gb2/gbrowse/CalCuv/" "Mozilla/5.0 (X11; Ubuntu; Linux i686; rv:20.0) Gecko/20100101 Firefox/20.0


Hence, can anyone give me some suggestion about how to fix it?


Thanks!

Jingjing


------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: gbrowse visualization error

JINGJING JIN-2
When I check the database CalCuv on my mysql like this:

mysql> USE CalCuv;
Reading table information for completion of table and column names
You can turn off this feature to get a quicker startup with -A

Database changed
mysql> select * from name;
+----+----------+--------------+
| id | name     | display_name |
+----+----------+--------------+
 |            1 |
     |            1 |
     |            1 |
     |            1 |
     |            1 |
     |            1 |
 |            1 |
     |            1 |
     |            1 |
+----+----------+--------------+
9 rows in set (0.00 sec)


It seems it doesn't load my data successfully into mysql database.

However, the command I use to load is from tutorial:

bp_seqfeature_load.pl -c -f -d CalCuv CaLCuV.fa CalCuvOnlyVirus.gff3

I am not sure where is wrong.

Can anyone fix it?

Thanks!

Jingjing




--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/gbrowse-visualization-error-tp5711616p5711617.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: gbrowse visualization error

Scott Cain
Hi Jingjing,

Can you attach a sample of you GFF and send that to the list?  I suspect there is something wrong with it (like it's not really 9 tab delimited columns).

Scott


Sent from my iPhone

On Aug 1, 2013, at 11:55 AM, jjjscuedu <[hidden email]> wrote:

> Jingjing

------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: gbrowse visualization error

JINGJING JIN-2
Dear Scott,

Thanks.

My file is very small.

CalcuvA    NCBI    chromosome    1    2583    .    .    .    ID=CalcuvA;Name=CalcuvA
CalcuvA    NCBI    gene    33    1567    .    +    .    ID=AC1;Name=AC1
CalcuvA    NCBI    gene    339    1094    .    +    .    ID=AV1;Name=AV1
CalcuvA    NCBI    gene    1091    1489    .    -    .    ID=AC3;Name=AC3
CalcuvA    NCBI    gene    1236    1625    .    -    .    ID=AC2;Name=AC2
CalcuvA    NCBI    gene    1567    2583    .    -    .    ID=test1
CalcuvA    NCBI    gene    2172    2537    .    -    .    ID=AC4;Name=AC4
CalcuvB    NCBI    chromosome    1    2513    .    .    .    ID=CalcuvB;Name=CalcuvB
CalcuvB    NCBI    gene    529    1299    .    +    .    ID=BV1;Name=BV1
CalcuvB    NCBI    gene    1357    2244    .    -    .    ID=BC1;Name=BC1

This is all the content for GFF file.

Thanks!


On Thu, Aug 1, 2013 at 12:16 PM, Scott Cain <[hidden email]> wrote:
Hi Jingjing,

Can you attach a sample of you GFF and send that to the list?  I suspect there is something wrong with it (like it's not really 9 tab delimited columns).

Scott


Sent from my iPhone

On Aug 1, 2013, at 11:55 AM, jjjscuedu <[hidden email]> wrote:

> Jingjing


------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: gbrowse visualization error

Scott Cain
Hi Jingjing,

I'm reading this from my phone, so I'm not sure, but I don't think you attached you GFF file. Cutting and pasting wipes out formatting like tabs, so it's not as good a test if I work from you pasted GFF. Please send the GFF as an attachment. 

Scott

Sent from my iPhone

On Aug 1, 2013, at 12:21 PM, JINGJING JIN <[hidden email]> wrote:

Dear Scott,

Thanks.

My file is very small.

CalcuvA    NCBI    chromosome    1    2583    .    .    .    ID=CalcuvA;Name=CalcuvA
CalcuvA    NCBI    gene    33    1567    .    +    .    ID=AC1;Name=AC1
CalcuvA    NCBI    gene    339    1094    .    +    .    ID=AV1;Name=AV1
CalcuvA    NCBI    gene    1091    1489    .    -    .    ID=AC3;Name=AC3
CalcuvA    NCBI    gene    1236    1625    .    -    .    ID=AC2;Name=AC2
CalcuvA    NCBI    gene    1567    2583    .    -    .    ID=test1
CalcuvA    NCBI    gene    2172    2537    .    -    .    ID=AC4;Name=AC4
CalcuvB    NCBI    chromosome    1    2513    .    .    .    ID=CalcuvB;Name=CalcuvB
CalcuvB    NCBI    gene    529    1299    .    +    .    ID=BV1;Name=BV1
CalcuvB    NCBI    gene    1357    2244    .    -    .    ID=BC1;Name=BC1

This is all the content for GFF file.

Thanks!


On Thu, Aug 1, 2013 at 12:16 PM, Scott Cain <[hidden email]> wrote:
Hi Jingjing,

Can you attach a sample of you GFF and send that to the list?  I suspect there is something wrong with it (like it's not really 9 tab delimited columns).

Scott


Sent from my iPhone

On Aug 1, 2013, at 11:55 AM, jjjscuedu <[hidden email]> wrote:

> Jingjing


------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: gbrowse visualization error

JINGJING JIN-2
I just do a samller change for my gff3 file [add a sequence feature for
chromosome ]like this:

CalcuvA NCBI chromosome 1 2583 . . .
ID=CalcuvA;Name=CalcuvA;Sequence=CalcuvA
CalcuvA NCBI gene 33 1567 . + . ID=AC1;Name=AC1
CalcuvA NCBI gene 339 1094 . + . ID=AV1;Name=AV1
CalcuvA NCBI gene 1091 1489 . - . ID=AC3;Name=AC3
CalcuvA NCBI gene 1236 1625 . - . ID=AC2;Name=AC2
CalcuvA NCBI gene 1567 2583 . - . ID=test1;Name=test1
CalcuvA NCBI gene 2172 2537 . - . ID=AC4;Name=AC4
CalcuvB NCBI chromosome 1 2513 . . .
ID=CalcuvB;Name=CalcuvB;Sequence=CalcuvA
CalcuvB NCBI gene 529 1299 . + . ID=BV1;Name=BV1
CalcuvB NCBI gene 1357 2244 . - . ID=BC1;Name=BC1

And use bp_seqfeature_load.pl load again.

After that, when I check the name table in mysql, it seems chromosome file
is load successfully.

mysql> USE CalCuv;
Reading table information for completion of table and column names
You can turn off this feature to get a quicker startup with -A

Database changed
mysql> show tables;
+------------------+
| Tables_in_CalCuv |
+------------------+
| attribute        |
| attributelist    |
| feature          |
| interval_stats   |
| locationlist     |
| meta             |
| name             |
| parent2child     |
| sequence         |
| typelist         |
+------------------+
10 rows in set (0.01 sec)

mysql> select * from name;
+----+---------+--------------+
| id | name    | display_name |
+----+---------+--------------+
|  1 | CalcuvA |            1 |
    |            1 |
    |            1 |
    |            1 |
    |            1 |
  |            1 |
    |            1 |
|  8 | CalcuvB |            1 |
    |            1 |
    |            1 |
+----+---------+--------------+
10 rows in set (0.00 sec)


However, the name of gene feature is not loaded successfully. However, it
can display on Gbrowse now.

Can anyone give me some suggestion about what is the relationship between
the sequence feature in gff file with bp_seqfeature module?

Is it any relationship because the configuration in conf file:

Below is my conf file:

[GENERAL]
description   = CalCuv chromosomes
database      = annotations

initial landmark = CalcuvA

balloon tips    = 1
aggregators =
plugins = Aligner RestrictionAnnotator TrackDumper


# where to link to when user clicks in detailed view
link          = AUTO
#link_target   = _blank

# what image widths to offer
#image widths  = 450 640 800 1024 1280


# size of the region
region segment         = 1500

autocomplete = 1

default tracks = gene
                 GC:region
                 


# The class of the feature that is used as the reference for all others
# "Sequence" is the default - change it if you use something else
r*eference class = Sequence*        /// is it because of this, however,
before I try other organism, has no relationship

# max and default segment sizes for detailed view
max segment     = 500000
default segment = 500

# zoom levels
zoom levels    = 50 100 200 1000 2000 5000 10000 20000 40000 100000 200000
500000 1000000

overview units = M
# whether to show the sources popup menu (0=false, 1=true; defaults to true)
show sources   = 1

# colors of the overview, detailed map and key
overview bgcolor = whitesmoke
detailed bgcolor = aliceblue
#key bgcolor      = lightsteelblue

# examples to show in the introduction
examples = AC1
         


# "automatic" classes to try when an unqualified identifier is given
automatic classes = chromosome gene

#################################
# database definitions
#################################

[annotations:database]
db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -adaptor DBI::mysql
                -dsn     CalCuv
                -user    nobody



--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/gbrowse-visualization-error-tp5711616p5711622.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
Get your SQL database under version control now!
Version control is standard for application code, but databases havent
caught up. So what steps can you take to put your SQL databases under
version control? Why should you start doing it? Read more to find out.
http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse