gff3 bulk loader trouble

classic Classic list List threaded Threaded
4 messages Options
Reply | Threaded
Open this post in threaded view
|

gff3 bulk loader trouble

Robert Buels
Is there a problem with the bulk loader, or am I just doing something
wrong?  It's been a while since I've used it.  On a clean chado install
from trunk, with RO and SO both loaded OK, I try to load a test fasta
file containing a single sequence (SL1.00sc00001), and the run goes like
this, and nothing gets loaded:

rob@banana chado$ perl -Iblib/lib blib/script/gmod_bulk_load_gff3.pl
--recreate_cache  --fastafile /tmp/test_load/foo.seq
(Re)creating the uniquename cache in the database...
Creating table...
Populating table...
Creating indexes...
Adjusting the primary key sequences (if necessary)...Done.
Preparing data for inserting into the chadotest database
(This may take a while ...)
No features where found with a unqiuename of SL1.00sc00001
and an organism_id of 29.  Are you sure you have the uniquename
right?  It might have been changed when loaded into the database to ensure
uniqueness.  Skipping this sequence...

Skipping feature table since the load file is empty...
Skipping featureloc table since the load file is empty...
Skipping feature_relationship table since the load file is empty...
Skipping featureprop table since the load file is empty...
Skipping feature_cvterm table since the load file is empty...
Skipping synonym table since the load file is empty...
Skipping feature_synonym table since the load file is empty...
Skipping dbxref table since the load file is empty...
Skipping feature_dbxref table since the load file is empty...
Skipping analysisfeature table since the load file is empty...
Skipping cvterm table since the load file is empty...
Skipping db table since the load file is empty...
Skipping cv table since the load file is empty...
Skipping analysis table since the load file is empty...
Skipping organism table since the load file is empty...
Loading sequences (if any) ...

Done.

------------------------------------------------------------------------------
This SF.net email is sponsored by Sprint
What will you do first with EVO, the first 4G phone?
Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
_______________________________________________
Gmod-schema mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-schema
Reply | Threaded
Open this post in threaded view
|

Re: gff3 bulk loader trouble

Scott Cain
Hi Rob,

There shouldn't be anything wrong; can you send the GFF file?

Scott


On Fri, Jul 2, 2010 at 2:46 PM, Robert Buels <[hidden email]> wrote:

> Is there a problem with the bulk loader, or am I just doing something
> wrong?  It's been a while since I've used it.  On a clean chado install
> from trunk, with RO and SO both loaded OK, I try to load a test fasta
> file containing a single sequence (SL1.00sc00001), and the run goes like
> this, and nothing gets loaded:
>
> rob@banana chado$ perl -Iblib/lib blib/script/gmod_bulk_load_gff3.pl
> --recreate_cache  --fastafile /tmp/test_load/foo.seq
> (Re)creating the uniquename cache in the database...
> Creating table...
> Populating table...
> Creating indexes...
> Adjusting the primary key sequences (if necessary)...Done.
> Preparing data for inserting into the chadotest database
> (This may take a while ...)
> No features where found with a unqiuename of SL1.00sc00001
> and an organism_id of 29.  Are you sure you have the uniquename
> right?  It might have been changed when loaded into the database to ensure
> uniqueness.  Skipping this sequence...
>
> Skipping feature table since the load file is empty...
> Skipping featureloc table since the load file is empty...
> Skipping feature_relationship table since the load file is empty...
> Skipping featureprop table since the load file is empty...
> Skipping feature_cvterm table since the load file is empty...
> Skipping synonym table since the load file is empty...
> Skipping feature_synonym table since the load file is empty...
> Skipping dbxref table since the load file is empty...
> Skipping feature_dbxref table since the load file is empty...
> Skipping analysisfeature table since the load file is empty...
> Skipping cvterm table since the load file is empty...
> Skipping db table since the load file is empty...
> Skipping cv table since the load file is empty...
> Skipping analysis table since the load file is empty...
> Skipping organism table since the load file is empty...
> Loading sequences (if any) ...
>
> Done.
>
> ------------------------------------------------------------------------------
> This SF.net email is sponsored by Sprint
> What will you do first with EVO, the first 4G phone?
> Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
> _______________________________________________
> Gmod-schema mailing list
> [hidden email]
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
This SF.net email is sponsored by Sprint
What will you do first with EVO, the first 4G phone?
Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
_______________________________________________
Gmod-schema mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-schema
Reply | Threaded
Open this post in threaded view
|

Re: gff3 bulk loader trouble

Robert Buels
Not gff, just a bare fasta file.  The loader is supposed to be able to
make features for those right?

Just a single fasta sequence:

 >SL1.00sc00001
AAAGTTCAGAGAATGGATTTTCACTGAAGTCTCCGTGACGGTCCATCACGCCTGTGACGG
TCCGTCCTGCCATTCCGTCACGAAGTTCAGAGAGTCGATTTTCAGTACCCAATTTCAGAT
TTTCTAAGTGTTTTGAAACGAGACCCTGCGACGGTACGTCGTGCCCATGACGGATCGTCG
TTTGGTCCGTCGCCTCAGCCTGTTTTTCCAGAATTGAAGTTTGTTGCTCAAAACGACTAA
ATAGGTCGTTACAATAGATACCAATTTACCCATCGTTCGTCCCCGAACGATCAAAAGAAG
GAAAACAAGGGCGAAAAGGAGTACCTGAATCTGTAAACAGATGTGGGTATTTTTCTCGCA
TATCCGCCTCCTTCTCCCAAGTGGCTTCTTCAATGGGTCGATTCTTCCATTGCATCTTGA
TGGATGCAATCTCTCTTGACCTCAACTTGCGAACTTCTCTATCTAAAATAGCAACAGGCT

Rob

Scott Cain wrote:

> Hi Rob,
>
> There shouldn't be anything wrong; can you send the GFF file?
>
> Scott
>
>
> On Fri, Jul 2, 2010 at 2:46 PM, Robert Buels <[hidden email]> wrote:
>> Is there a problem with the bulk loader, or am I just doing something
>> wrong?  It's been a while since I've used it.  On a clean chado install
>> from trunk, with RO and SO both loaded OK, I try to load a test fasta
>> file containing a single sequence (SL1.00sc00001), and the run goes like
>> this, and nothing gets loaded:
>>
>> rob@banana chado$ perl -Iblib/lib blib/script/gmod_bulk_load_gff3.pl
>> --recreate_cache  --fastafile /tmp/test_load/foo.seq
>> (Re)creating the uniquename cache in the database...
>> Creating table...
>> Populating table...
>> Creating indexes...
>> Adjusting the primary key sequences (if necessary)...Done.
>> Preparing data for inserting into the chadotest database
>> (This may take a while ...)
>> No features where found with a unqiuename of SL1.00sc00001
>> and an organism_id of 29.  Are you sure you have the uniquename
>> right?  It might have been changed when loaded into the database to ensure
>> uniqueness.  Skipping this sequence...
>>
>> Skipping feature table since the load file is empty...
>> Skipping featureloc table since the load file is empty...
>> Skipping feature_relationship table since the load file is empty...
>> Skipping featureprop table since the load file is empty...
>> Skipping feature_cvterm table since the load file is empty...
>> Skipping synonym table since the load file is empty...
>> Skipping feature_synonym table since the load file is empty...
>> Skipping dbxref table since the load file is empty...
>> Skipping feature_dbxref table since the load file is empty...
>> Skipping analysisfeature table since the load file is empty...
>> Skipping cvterm table since the load file is empty...
>> Skipping db table since the load file is empty...
>> Skipping cv table since the load file is empty...
>> Skipping analysis table since the load file is empty...
>> Skipping organism table since the load file is empty...
>> Loading sequences (if any) ...
>>
>> Done.
>>
>> ------------------------------------------------------------------------------
>> This SF.net email is sponsored by Sprint
>> What will you do first with EVO, the first 4G phone?
>> Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
>> _______________________________________________
>> Gmod-schema mailing list
>> [hidden email]
>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>
>
>
>


------------------------------------------------------------------------------
This SF.net email is sponsored by Sprint
What will you do first with EVO, the first 4G phone?
Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
_______________________________________________
Gmod-schema mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-schema
Reply | Threaded
Open this post in threaded view
|

Re: gff3 bulk loader trouble

Scott Cain
Hi Rob,

You need to create gff3 from that; see gmod_fasta2gff3.pl.

Scott


On Fri, Jul 2, 2010 at 3:15 PM, Robert Buels <[hidden email]> wrote:

> Not gff, just a bare fasta file.  The loader is supposed to be able to make
> features for those right?
>
> Just a single fasta sequence:
>
>>SL1.00sc00001
> AAAGTTCAGAGAATGGATTTTCACTGAAGTCTCCGTGACGGTCCATCACGCCTGTGACGG
> TCCGTCCTGCCATTCCGTCACGAAGTTCAGAGAGTCGATTTTCAGTACCCAATTTCAGAT
> TTTCTAAGTGTTTTGAAACGAGACCCTGCGACGGTACGTCGTGCCCATGACGGATCGTCG
> TTTGGTCCGTCGCCTCAGCCTGTTTTTCCAGAATTGAAGTTTGTTGCTCAAAACGACTAA
> ATAGGTCGTTACAATAGATACCAATTTACCCATCGTTCGTCCCCGAACGATCAAAAGAAG
> GAAAACAAGGGCGAAAAGGAGTACCTGAATCTGTAAACAGATGTGGGTATTTTTCTCGCA
> TATCCGCCTCCTTCTCCCAAGTGGCTTCTTCAATGGGTCGATTCTTCCATTGCATCTTGA
> TGGATGCAATCTCTCTTGACCTCAACTTGCGAACTTCTCTATCTAAAATAGCAACAGGCT
>
> Rob
>
> Scott Cain wrote:
>>
>> Hi Rob,
>>
>> There shouldn't be anything wrong; can you send the GFF file?
>>
>> Scott
>>
>>
>> On Fri, Jul 2, 2010 at 2:46 PM, Robert Buels <[hidden email]> wrote:
>>>
>>> Is there a problem with the bulk loader, or am I just doing something
>>> wrong?  It's been a while since I've used it.  On a clean chado install
>>> from trunk, with RO and SO both loaded OK, I try to load a test fasta
>>> file containing a single sequence (SL1.00sc00001), and the run goes like
>>> this, and nothing gets loaded:
>>>
>>> rob@banana chado$ perl -Iblib/lib blib/script/gmod_bulk_load_gff3.pl
>>> --recreate_cache  --fastafile /tmp/test_load/foo.seq
>>> (Re)creating the uniquename cache in the database...
>>> Creating table...
>>> Populating table...
>>> Creating indexes...
>>> Adjusting the primary key sequences (if necessary)...Done.
>>> Preparing data for inserting into the chadotest database
>>> (This may take a while ...)
>>> No features where found with a unqiuename of SL1.00sc00001
>>> and an organism_id of 29.  Are you sure you have the uniquename
>>> right?  It might have been changed when loaded into the database to
>>> ensure
>>> uniqueness.  Skipping this sequence...
>>>
>>> Skipping feature table since the load file is empty...
>>> Skipping featureloc table since the load file is empty...
>>> Skipping feature_relationship table since the load file is empty...
>>> Skipping featureprop table since the load file is empty...
>>> Skipping feature_cvterm table since the load file is empty...
>>> Skipping synonym table since the load file is empty...
>>> Skipping feature_synonym table since the load file is empty...
>>> Skipping dbxref table since the load file is empty...
>>> Skipping feature_dbxref table since the load file is empty...
>>> Skipping analysisfeature table since the load file is empty...
>>> Skipping cvterm table since the load file is empty...
>>> Skipping db table since the load file is empty...
>>> Skipping cv table since the load file is empty...
>>> Skipping analysis table since the load file is empty...
>>> Skipping organism table since the load file is empty...
>>> Loading sequences (if any) ...
>>>
>>> Done.
>>>
>>>
>>> ------------------------------------------------------------------------------
>>> This SF.net email is sponsored by Sprint
>>> What will you do first with EVO, the first 4G phone?
>>> Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> [hidden email]
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>
>>
>>
>
>



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
This SF.net email is sponsored by Sprint
What will you do first with EVO, the first 4G phone?
Visit sprint.com/first -- http://p.sf.net/sfu/sprint-com-first
_______________________________________________
Gmod-schema mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-schema