using ybrowse

classic Classic list List threaded Threaded
2 messages Options
Reply | Threaded
Open this post in threaded view
|

using ybrowse

krkerwin

Thomas:

 

I just sent Astrid an email regarding ybrowse when I found this email address at the bottom of the webpage.  I was able to download the Variant Frequency by Haplogroup and now need to get the info below to submit our CTS4466 SNPs to ISOGG

 

I need to use ybrowse to find the following for example.  I’ve used the previous database when my family took the WTY test but have since forgotten the details.

 

Name:

CTS11338

Type:

snp

Source:

point

Position:

ChrY:23075481..23075481 (+ strand)

Length:

1

ISOGG_haplogroup:

not listed

YCC_haplogroup:

Aprrox. hg: I

allele_anc:

C

allele_der:

T

comments:

Syn. with CTS10400

count_derived:

0

count_tested:

4

mutation:

C to T

primer_f:

CTS11338_F TGACAGGGGGATGCTTATTG

primer_r:

CTS11338_R GTGTTCCATCAGCCTGTGAG

ref:

Chris Tyler-Smith (2011)

primary_id:

81101

gbrowse_dbid:

chrY:database

 

Thank you very much in advance.  We have quite a few SNPs to submit thanks to you and Astrid.

 

Apparently ISOGG is starting almost from scratch for the R Haplogroup which I believe is likely based on updated technology and methodology used in the submission process.

 

Kathleen

 

 


------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Reply | Threaded
Open this post in threaded view
|

Re: using ybrowse

Scott Cain
Hi Kathleen,

You've reached the mailing list for supporting people who installed GBrowse, which is the software that powers the genome browser at YBrowse.  If you go back to YBrowse, you should find an email address for contacting them about data issues.

Scott


On Tue, Oct 14, 2014 at 12:47 AM, <[hidden email]> wrote:

Thomas:

 

I just sent Astrid an email regarding ybrowse when I found this email address at the bottom of the webpage.  I was able to download the Variant Frequency by Haplogroup and now need to get the info below to submit our CTS4466 SNPs to ISOGG

 

I need to use ybrowse to find the following for example.  I’ve used the previous database when my family took the WTY test but have since forgotten the details.

 

Name:

CTS11338

Type:

snp

Source:

point

Position:

ChrY:23075481..23075481 (+ strand)

Length:

1

ISOGG_haplogroup:

not listed

YCC_haplogroup:

Aprrox. hg: I

allele_anc:

C

allele_der:

T

comments:

Syn. with CTS10400

count_derived:

0

count_tested:

4

mutation:

C to T

primer_f:

CTS11338_F TGACAGGGGGATGCTTATTG

primer_r:

CTS11338_R GTGTTCCATCAGCCTGTGAG

ref:

Chris Tyler-Smith (2011)

primary_id:

81101

gbrowse_dbid:

chrY:database

 

Thank you very much in advance.  We have quite a few SNPs to submit thanks to you and Astrid.

 

Apparently ISOGG is starting almost from scratch for the R Haplogroup which I believe is likely based on updated technology and methodology used in the submission process.

 

Kathleen

 

 


------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
[hidden email]
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse